AEM
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
AEM.02127-07v1
74/5/1656    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Google Scholar
Right arrow Articles by Zozaya-Hinchliffe, M.
Right arrow Articles by Ferris, M. J.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zozaya-Hinchliffe, M.
Right arrow Articles by Ferris, M. J.
Agricola
Right arrow Articles by Zozaya-Hinchliffe, M.
Right arrow Articles by Ferris, M. J.
Applied and Environmental Microbiology, March 2008, p. 1656-1659, Vol. 74, No. 5
0099-2240/08/$08.00+0     doi:10.1128/AEM.02127-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Prevalence and Abundance of Uncultivated Megasphaera-Like Bacteria in the Human Vaginal Environment{triangledown}

Marcela Zozaya-Hinchliffe,1 David H. Martin,3 and Michael J. Ferris1,2*

Department of Pediatrics,2 Department of Internal Medicine, Louisiana State University Health Sciences Center,3 The Research Institute for Children, New Orleans, Louisiana1

Received 17 September 2007/ Accepted 7 January 2008


   ABSTRACT
Top
 ABSTRACT
INTRODUCTION
 Nucleotide sequence accession...
 REFERENCES
 
Cultivation-independent analysis of 16S rRNA gene sequences in vaginal samples revealed two previously unrecognized, uncultivated Megasphaera-like phylotypes. Phylogenetic analysis and environmental distribution suggest that these Megasphaera types may be unique to the vaginal environment. Quantitative PCR suggests that both phylotypes are present in higher concentrations in women with bacterial vaginosis.


   INTRODUCTION
Top
 ABSTRACT
 INTRODUCTION
Nucleotide sequence accession...
 REFERENCES
 
Bacterial vaginosis (BV) is the most common cause of vaginal irritation and is associated with serious morbidities such as adverse pregnancy outcomes (20, 21) and increased risk of human immunodeficiency virus infection (7, 17, 25, 27). No single etiologic agent has been implicated as the cause of BV, and the syndrome has been referred to as a polymicrobial disorder (9, 22). Cultivation-independent analyses of 16S rRNA gene sequences show that previously unrecognized species are prevalent in the vaginal flora (4, 10, 11, 13, 14, 28, 30). Among these are uncultivated species most closely related to Megasphaera (11, 14, 28, 30). The clinical significance of vaginal Megasphaera is unknown. To investigate the association of Megasphaera with various grades of vaginal flora, we developed quantitative real-time PCR (qRT-PCR) assays targeting two Megasphaera-like 16S phylotypes, termed Megasphaera types 1 and 2, and evaluated their prevalence and relative abundance in patients whose vaginal flora had been clinically and microscopically defined as normal, intermediate, or BV.

DNA extracted (High Pure PCR template preparation kit; Roche Molecular Diagnostics, Penzberg, Germany) from 41 vaginal swab specimens used originally for detection of Mycoplasma genitalium to determine the etiology of mucopurulent cervicitis was studied here. The LSU Health Sciences Center Institutional Review Board protocol describing the study population and sampling is available upon request. The vaginal flora of each patient was characterized clinically using Amsel's criteria (1) and Nugent vaginal Gram stain scores (18, 29). Normal and BV flora were defined by Nugent scores of ≤3 and ≥7, respectively. Plasmids were purified using a QIAprep spin miniprep kit (Qiagen, Valencia, CA). Genomic and plasmid DNA were quantified using a TBS-380 fluorometer (Turner Biosystems, Sunnyvale, CA) and Quant-iT PicoGreen double-strand-DNA reagent (Invitrogen, Carlsbad, CA). Plasmid copies were calculated with the DNA copy number calculator at the URI Genomics and Sequencing Center web site (24). PCR primers targeting Megasphaera type 1 and type 2 were designed using Primrose (2). The primer sequences for type 1 are 5'GACGGATGCCAACAGTATCCGTCCG3' and 5'AAGTTCGACAGTTTCCGTCCCCTC3'; the primers for type 2 are 5'CGGCAAGGTGGTAAATAGCCATCA3' and 5'ACTCAAGTCTTCCAGTTTCGGTCC3'. Cross-reactivity between Megasphaera type 1 and 2 assays was tested using plasmid clones from our vaginal PCR survey (14), and results were negative. Total bacterial 16S rRNA gene concentration was measured in vaginal DNA specimens as previously described (3) using the primer sequences 5'CCTACGGGAGGCAGCAG3' and 5'ATTACCGCGGCTGCTGGC3'. In our analyses, the sensitivity of this assay was limited to 104 templates per qRT-PCR. All assays were performed on an iCycler (Bio-Rad, Hercules, CA) using iQ-SYBR green PCR supermix (Bio-Rad) with 10 ng of vaginal template DNA and a 0.5 µM final concentration of each primer. Temperature cycling for all assays was 95°C for 2.5 min, followed by 40 cycles at 95°C for 30 s, 64°C for 30 s, and 72°C for 30 s; annealing was 65°C for the total bacterial assay. Cloned Megasphaera type 1 and 2 16S rRNA genes from vaginal clone libraries (10) were used to generate 10-fold serial dilutions for standard curves. Threshold cycles from standard curves were used to calculate the number of Megasphaera type 1 and 2 16S rRNA gene sequences in vaginal DNA specimens (8). All qRT-PCR products were visualized in ethidium bromide-stained agarose gels and sequenced to confirm specificity (Davis Sequencing, Inc., Davis, CA).

A dendrogram illustrating the relationship between vaginal Megasphaera phylotypes and Megasphaera spp. from other environments was created using 28 nearly full-length (~1,390-nt) Megasphaera sequences from studies of gut, oral, vaginal, and other environments. Some shorter Megasphaera type 1 and 2 (~900-nt) sequences were added to the tree to document the origin of all members of the two vaginal phylotypes. Sequences were obtained from the Ribosomal Database Project (15) and from GenBank. Sequences were aligned using ClustalW (5). Alignments were checked and adjusted using Jalview (6). A Dialister pneumosintes sequence was used as an outgroup (16). The tree was constructed using the neighbor-joining method (19) with the Jukes-Cantor model implemented in the PAUP software (26). Bootstrap analysis (100 replicates) was performed to test the significance of the nodes.

Statistical calculations were performed using GraphPad Prism version 5.0 for Windows (GraphPad Software, San Diego, CA). Differences in the qRT-PCR values obtained for Megasphaera types 1 and 2 across patient groups defined by Nugent scores were evaluated by Student's t test analysis. The significance of the association between patient groups (BV and normal) and presence of Megasphaera types 1 and 2 was measured by Fisher's exact test. Statistical significance was set at an {alpha} value of ≤0.05, and all tests were two-sided.

The dendrogram shows that Megasphaera type 1 and 2 sequences form two well-supported clades (Fig. 1). No sequences in these clades originate from oral, gut, rumen, or other environments, suggesting that Megasphaera type 1 and 2 organisms may be uniquely adapted to the genitourinary environment. Megasphaera sequences within the type 1 clade share a high degree of similarity (98 to 99%) with each other, as do those within the type 2 clade (98 to 99%). Sequences within the type 1 and 2 clades share 95 to 96% similarity with those of their nearest relatives. This suggests that phylotypes 1 and 2 likely represent new species (23).


Figure 1
View larger version (27K):
[in this window]
[in a new window]

  		FIG. 1. Neighbor-joining tree of 16S rRNA gene sequences showing the phylogenetic positions of the vaginal Megasphaera type 1 and type 2 sequences within the Megasphaera genus. Bootstrap values are shown at the branch points as percentages of 100 analyses. GenBank accession numbers precede the names.

 
Measurements of Megasphaera type 1 and type 2 and total bacterial 16S rRNA gene concentrations in vaginal specimens of 41 patients are shown in Fig. 2. Vaginal specimens are arranged according to increasing Nugent score. Megasphaera type 1 was more prevalent than Megasphaera type 2, as it was detected in 38 (76%) versus 22 (52%) patients, respectively (P = 0.0004) (Fig. 2A and B). Megasphaera type 1 concentrations were dramatically higher (5 orders of magnitude) in all patients with the highest possible indication of BV (Nugent = 10, Amsel = 4) than in patients with the highest possible indication of normal flora (Nugent = 0, Amsel = 0) (P = 0.0114). Meanwhile, total bacterial concentrations between these extreme patient groups differed by 2 orders of magnitude (P ≤ 0.0001). Megasphaera type 1 appears to have a stronger association with BV (P = 0.0072) than type 2 (P = 0.0366). The quantitative analyses in this study correlate with previous, presumably less quantitative, broad-range molecular studies in which PCR amplification of 16S rRNA genes and clone library analyses showed that Megasphaera type 1 clones were more prevalent and abundant in vaginal specimens of BV patients than Megasphaera type 2 (11). However, it should be noted that even though Megasphaera type 1 seems to be strongly associated with BV, it was detected in a number of women with clinically normal Nugent scores, both in this study and in PCR-based analyses of normal patients by others (12). Thus, measurements of species abundance may provide a more informative view of the vaginal ecology.


Figure 2
View larger version (89K):
[in this window]
[in a new window]

  		FIG. 2. Quantitative analysis of 16S rRNA genes from Megasphaera types 1 and 2 in vaginal samples clinically evaluated by Nugent scoring and Amsel's criteria. Light gray bars indicate total bacteria. Each point represents the average value from two assays (four replicates). Standard deviations are shown as error bars.

 

   Nucleotide sequence accession numbers.
Top
 ABSTRACT
 INTRODUCTION
 Nucleotide sequence accession...
REFERENCES
 
GenBank accession numbers EF120358 and EF120359 were assigned to the sequences determined in this study.


   ACKNOWLEDGMENTS
 
This study was supported by an LSUHSC Translational Research Award, by NIH/NIAID Gulf South STI-TM CRC grant U19 AI061972, and by The Research Institute for Children, New Orleans, LA.


   FOOTNOTES
 
* Corresponding author. Mailing address: Research and Education Bldg., Children's Hospital, 200 Henry Clay Ave., New Orleans, LA 70118. Phone: (504) 896-5379. Fax: (504) 896-9413. E-mail: mferris{at}chnola-research.org Back

{triangledown} Published ahead of print on 18 January 2008. Back


   REFERENCES
Top
 ABSTRACT
 INTRODUCTION
 Nucleotide sequence accession...
 REFERENCES
 

  1. Amsel, R., P. A. Totten, C. A. Spiegel, K. C. Chen, D. Eschenbach, and K. K. Holmes. 1983. Nonspecific vaginitis. Diagnostic criteria and microbial and epidemiologic associations. Am. J. Med. 74:14-22.[CrossRef][Medline]
  2. Ashelford, K. E., A. J. Weightman, and J. C. Fry. 2002. PRIMROSE: a computer program for generating and estimating the phylogenetic range of 16S rRNA oligonucleotide probes and primers in conjunction with the RDP-II database. Nucleic Acids Res. 30:3481-3489.[Abstract/Free Full Text]
  3. Bathe, S., and M. Hausner. 2006. Design and evaluation of 16S rRNA sequence based oligonucleotide probes for the detection and quantification of Comamonas testosteroni in mixed microbial communities. BMC Microbiol. 6:54.[CrossRef][Medline]
  4. Burton, J. P., E. Devillard, P. A. Cadieux, J. A. Hammond, and G. Reid. 2004. Detection of Atopobium vaginae in postmenopausal women by cultivation-independent methods warrants further investigation. J. Clin. Microbiol. 42:1829-1831.[Abstract/Free Full Text]
  5. Chenna, R., H. Sugawara, T. Koike, R. Lopez, T. J. Gibson, D. G. Higgins, and J. D. Thompson. 2003. Multiple sequence alignment with the Clustal series of programs (http://www.ebi.ac.uk/clustalw/). Nucleic Acids Res. 31:3497-3500.[Abstract/Free Full Text]
  6. Clamp, M., J. Cuff, S. M. Searle, and G. J. Barton. 2004. The Jalview Java alignment editor. Bioinformatics 20:426-427.[Abstract/Free Full Text]
  7. Cohen, C. R., A. Duerr, N. Pruithithada, S. Rugpao, S. Hillier, P. Garcia, and K. Nelson. 1995. Bacterial vaginosis and HIV seroprevalence among female commercial sex workers in Chiang Mai, Thailand. AIDS 9:1093-1097.[Medline]
  8. Dumonceaux, T. J., J. E. Hill, S. A. Briggs, K. K. Amoako, S. M. Hemmingsen, and A. G. Van Kessel. 2006. Enumeration of specific bacterial populations in complex intestinal communities using quantitative PCR based on the chaperonin-60 target. J. Microbiol. Methods 64:46-62.[CrossRef][Medline]
  9. Eschenbach, D. A., P. R. Davick, B. L. Williams, S. J. Klebanoff, K. Young-Smith, C. M. Critchlow, and K. K. Holmes. 1989. Prevalence of hydrogen peroxide-producing Lactobacillus species in normal women and women with bacterial vaginosis. J. Clin. Microbiol. 27:251-256.[Abstract/Free Full Text]
  10. Ferris, M. J., J. Norori, M. Zozaya-Hinchliffe, and D. H. Martin. 2007. Cultivation-independent analysis of changes in bacterial vaginosis flora following metronidazole treatment. J. Clin. Microbiol. 45:1016-1018.[Abstract/Free Full Text]
  11. Fredricks, D. N., T. L. Fiedler, and J. M. Marrazzo. 2005. Molecular identification of bacteria associated with bacterial vaginosis. N. Engl. J. Med. 353:1899-1911.[Abstract/Free Full Text]
  12. Fredricks, D. N., T. L. Fiedler, K. K. Thomas, B. B. Oakley, and J. M. Marrazzo. 2007. Targeted PCR for detection of vaginal bacteria associated with bacterial vaginosis. J. Clin. Microbiol. 45:3270-3276.[Abstract/Free Full Text]
  13. Hill, J. E., S. H. Goh, D. M. Money, M. Doyle, A. Li, W. L. Crosby, M. Links, A. Leung, D. Chan, and S. M. Hemmingsen. 2005. Characterization of vaginal microflora of healthy, nonpregnant women by chaperonin-60 sequence-based methods. Am. J. Obstet. Gynecol. 193:682-692.[CrossRef][Medline]
  14. Hyman, R. W., M. Fukushima, L. Diamond, J. Kumm, L. C. Giudice, and R. W. Davis. 2005. Microbes on the human vaginal epithelium. Proc. Natl. Acad. Sci. USA 102:7952-7957.[Abstract/Free Full Text]
  15. Maidak, B. L., J. R. Cole, T. G. Lilburn, C. T. Parker, Jr., P. R. Saxman, R. J. Farris, G. M. Garrity, G. J. Olsen, T. M. Schmidt, and J. M. Tiedje. 2001. The RDP-II (Ribosomal Database Project). Nucleic Acids Res. 29:173-174.[Abstract/Free Full Text]
  16. Marchandin, H., E. Jumas-Bilak, B. Gay, C. Teyssier, H. Jean-Pierre, M. S. de Buochberg, C. Carriere, and J. P. Carlier. 2003. Phylogenetic analysis of some Sporomusa sub-branch members isolated from human clinical specimens: description of Megasphaera micronuciformis sp. nov. Int. J. Syst. Evol. Microbiol. 53:547-553.[CrossRef]
  17. Martin, H. L., B. A. Richardson, P. M. Nyange, L. Lavreys, S. L. Hillier, B. Chohan, K. Mandaliya, J. O. Ndinya-Achola, J. Bwayo, and J. Kreiss. 1999. Vaginal lactobacilli, microbial flora, and risk of human immunodeficiency virus type 1 and sexually transmitted disease acquisition. J. Infect. Dis. 180:1863-1868.[CrossRef][Medline]
  18. Nugent, R. P., M. A. Krohn, and S. L. Hillier. 1991. Reliability of diagnosing bacterial vaginosis is improved by a standardized method of Gram stain interpretation. J. Clin. Microbiol. 29:297-301.[Abstract/Free Full Text]
  19. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425.[Abstract]
  20. Sobel, J. D. 2000. Bacterial vaginosis. Annu. Rev. Med. 51:349-356.[CrossRef][Medline]
  21. Spiegel, C. A. 1991. Bacterial vaginosis. Clin. Microbiol. Rev. 4:485-502.[Abstract/Free Full Text]
  22. Spiegel, C. A., R. Amsel, D. Eschenbach, F. Schoenknecht, and K. K. Holmes. 1980. Anaerobic bacteria in nonspecific vaginitis. N. Engl. J. Med. 303:601-607.[Abstract]
  23. Stackebrandt, E., and J. Ebers. 2006. Taxonomic parameters revisited: tarnished gold standards. Microbiol. Today 33:152-155.
  24. Staroscik, A. 2004, posting date. Calculator for determining the number of copies of a template. http://www.uri.edu/research/gsc/resources/cndna.html.
  25. Sturm-Ramirez, K., A. Gaye-Diallo, G. Eisen, S. Mboup, and P. J. Kanki. 2000. High levels of tumor necrosis factor-alpha and interleukin-1β in bacterial vaginosis may increase susceptibility to human immunodeficiency virus. J. Infect. Dis. 182:467-473.[CrossRef][Medline]
  26. Swofford, D. 2002. PAUP—Phylogenetic Analysis Using Parsimony (and other methods), version 4.0. Sinauer Associates, Sunderland, MA.
  27. Taha, T. E., R. H. Gray, N. I. Kumwenda, D. R. Hoover, L. A. Mtimavalye, G. N. Liomba, J. D. Chiphangwi, G. A. Dallabetta, and P. G. Miotti. 1999. HIV infection and disturbances of vaginal flora during pregnancy. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 20:52-59.[Medline]
  28. Verhelst, R., H. Verstraelen, G. Claeys, G. Verschraegen, J. Delanghe, L. Van Simaey, C. De Ganck, M. Temmerman, and M. Vaneechoutte. 2004. Cloning of 16S rRNA genes amplified from normal and disturbed vaginal microflora suggests a strong association between Atopobium vaginae, Gardnerella vaginalis and bacterial vaginosis. BMC Microbiol. 4:16.[CrossRef][Medline]
  29. Wolrath, H., U. Forsum, P. G. Larsson, and H. Boren. 2001. Analysis of bacterial vaginosis-related amines in vaginal fluid by gas chromatography and mass spectrometry. J. Clin. Microbiol. 39:4026-4031.[Abstract/Free Full Text]
  30. Zhou, X., S. J. Bent, M. G. Schneider, C. C. Davis, M. R. Islam, and L. J. Forney. 2004. Characterization of vaginal microbial communities in adult healthy women using cultivation-independent methods. Microbiology 150:2565-2573.[Abstract/Free Full Text]

Applied and Environmental Microbiology, March 2008, p. 1656-1659, Vol. 74, No. 5
0099-2240/08/$08.00+0     doi:10.1128/AEM.02127-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
AEM.02127-07v1
74/5/1656    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Google Scholar
Right arrow Articles by Zozaya-Hinchliffe, M.
Right arrow Articles by Ferris, M. J.
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zozaya-Hinchliffe, M.
Right arrow Articles by Ferris, M. J.
Agricola
Right arrow Articles by Zozaya-Hinchliffe, M.
Right arrow Articles by Ferris, M. J.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Microbiol. Mol. Biol. Rev. Eukaryot. Cell All ASM Journals