Previous Article | Next Article ![]()
Applied and Environmental Microbiology, May 2008, p. 2637-2645, Vol. 74, No. 9
0099-2240/08/$08.00+0 doi:10.1128/AEM.02882-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Department of Microbiology,1 Inflammation Program, Department of Medicine, Roy J. and Lucille A. Carver School of Medicine, University of Iowa, Iowa City, Iowa 522422
Received 20 December 2007/ Accepted 5 March 2008
|
|
|---|
0.1% of the population is recovered with Tn5 insertions in the chromosome. Nucleotide sequence analysis of a sample of mutants revealed that the insertions occur randomly throughout the chromosome. The kanamycin-selectable marker of the transposon is also flanked by FLP recombination target sequences that allow deletion of the antibiotic resistance gene when desired. This system has been used to generate transposon mutant libraries for the F. tularensis live vaccine strain as well as two different virulent F. tularensis strains. Chromosomal reporters delivered with the transposon were used to identify genes upregulated by growth in Chamberlain's defined medium. Genes in the fsl operon, reported to be involved in iron acquisition, as well as genes in the igl gene cluster were among those identified by the screen. Further experiments implicate the ferric uptake regulator (Fur) protein in the negative regulation of fsl but not igl reporters, which occurs in an iron-dependent manner. Our results indicate that we have created a valuable new transposon that can be used to identify and characterize virulence genes in F. tularensis strains. |
|
|---|
The development of genetic techniques and tools for studying Francisella pathogenesis has driven much of the progress that is being made in understanding the molecular pathogenesis of this organism. Some early efforts to identify virulence factors of Francisella relied upon nonspecific mutagenesis techniques (7, 39, 49) or unstable transposon insertions (Tn10 or Tn1721) (3-6, 12, 25, 29, 40). Additionally, Escherichia coli-Francisella shuttle vectors constructed for site-directed mutagenesis experiments (27, 35, 36, 43, 48) or for screening a promoter fusion library with a chloramphenicol acetyltransferase reporter gene (27) have been constructed. Other groups have used EZ::TN (Epicentre) transposon-transposase complexes to obtain stable Tn5 insertions in the chromosome of F. tularensis LVS (26, 51), F. tularensis subsp. novicida (21, 54), or F. tularensis Schu S4 (47). Recently, Maier et al. reported the development of a Himar1-based transposon system for creating mutants of F. tularensis (37).
The development of microarray and proteomic technologies provides alternative approaches relative to traditional transposon promoter fusion constructions for the study of gene and protein expression in bacteria. An advantage of a microarray or proteomic approach is that the expression of every bacterial gene or gene product can be compared under two or more conditions. A comprehensive view of the bacterial genome or proteome is difficult to achieve with transposon promoter fusions since one must simultaneously examine thousands of individual mutant strains. However, a transposon-based reporter library has unique and important advantages over either of the more global approaches. For instance, insertion of a transposon reporter into a given gene creates a mutant strain, in addition to creating a promoter reporter strain. With the mutant isolate in hand, work to characterize the mutated gene can be initiated very quickly. Another significant advantage is the ability to remutagenize a reporter strain to identify regulatory elements that govern expression of the gene. This allows regulatory pathways to be uncovered and characterized, which significantly increases our understanding of bacterial gene expression and signal transduction.
In this study, we report the construction of a highly efficient Francisella tularensis mutagenesis system that employs the hyperactive Tn5 transposase. Expression of the transposase has been placed under the dual control of the Francisella groES promoter and the lac operator and LacI repressor. The transposase, which resides outside the insertion sequences (mosaic ends), catalyzes insertion of the transposable element that carries a kanamycin resistance gene, flanked by FLP recombination target (FRT) sequences, and the pir-dependent R6K origin of replication into the Francisella chromosome. The transposon is delivered from a conditionally replicating (temperature-sensitive) F. tularensis plasmid (36) that, at high temperatures, allows the selection of insertions into the Francisella chromosome due to the loss of replication of the temperature-sensitive plasmid. Our results indicate that this transposon mutagenesis system produces single, random, stable insertions into the chromosomes of F. tularensis strains and is capable of creating a saturating Tn5 insertion library in a single experiment. In addition, derivatives of this system have been engineered to allow the creation of chromosomal luxCDABE or lacZ as transcriptional reporters.
We have utilized this system to create and screen a transposon library of F. tularensis LVS for differential gene expression when grown on modified Mueller-Hinton (MMH) or Chamberlain's defined medium (CDM). Reports in the literature indicate that growth of F. tularensis on CDM results in increased capsule production as well as increased type IV pilus expression (9, 22). In addition, it has been reported that growth on CDM causes a general increase in virulence of Francisella in a mouse model (9). Based upon the idea that CDM may upregulate virulence gene expression, we screened F. tularensis LVS transcriptional reporter libraries on MMH and CDM growth media. These screens have successfully identified established virulence genes as well as new genes that may play a role in the pathogenic lifestyle of F. tularensis. Some of the genes identified are involved in iron acquisition, suggesting that low iron availability is one of the signals sensed by Francisella on CDM agar that lead to upregulation of gene expression. Other groups have also reported iron availability as a signal resulting in differential expression of genes in F. tularensis (17, 30, 52). Classically, the ferric uptake regulator (Fur) functions as an iron-dependent transcriptional repressor by binding to DNA in the presence of ferrous iron (19). Sequences resembling Fur binding sites (Fur boxes) have been identified upstream of iron-regulated genes in F. tularensis (17, 52), although data linking Fur to regulation of these genes have not been presented. Based upon our observations and data published by others, we examined the role of Fur in the transcriptional regulation of two Francisella gene clusters that respond to iron concentration. We present evidence that suggests that Fur may regulate these two gene clusters by different mechanisms.
In summary, in this work we describe the construction and use of a Tn5 transposon delivery system that is capable of creating random, stable insertions in F. tularensis spp. We also present data demonstrating that chromosomal lacZ transcriptional reporters can be used to identify differentially regulated genes and quantify gene expression in F. tularensis. Finally, we have preliminary data that Fur is a negative regulator of transcription of the fslABCD operon but not the iglABCD operon.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Bacterial strains and plasmids used in this study
|
![]() View larger version (21K): [in a new window] |
FIG. 1. Construction of plasmids carrying a modified mini-Tn5 transposon. The plasmid pBDJ303 was derived from pRL27. Plasmid pRL27 carries a hyperactive Tn5 transposase outside the mosaic ends, which define the transposed element. Within the mosaic ends are the R6K plasmid origin and the kanamycin resistance gene aphA3. This plasmid was modified by cloning a DNA fragment carrying lacIq, the Francisella groES promoter, and the lac operator upstream of the hyperactive transposase gene tnp. In addition, the Francisella omp26 promoter was cloned upstream of the aphA3, gene which was modified by flanking with FRT sequences. The original features of plasmid pRL27 are shown in black, and the modifications are gray. Plasmid pMKM219 (features are shown in white) was digested with SpeI and ligated to SpeI-cut pBDJ303 to form the E. coli-Francisella temperature-sensitive Tn5 delivery plasmid pBB107. Plasmid pBB107 confers kanamycin and spectinomycin resistance and is 12.4 kb in size.
|
108 CFU F. tularensis LVS that were suspended in Francisella transformation buffer (0.2 M MgSO4, 0.1 M Tris-acetate, pH 7.5), frozen in liquid nitrogen, and then thawed. The transformed bacteria were grown in either MMH broth or on MMH agar without selection at 30°C for 7 h. Dilutions of the transformed bacteria were plated on MMH agar with 25 µg/ml spectinomycin at 30°C to select for F. tularensis containing the transposon delivery plasmid pBB107.
Transposon selection protocol.
Colonies obtained after
3 days of growth at 30°C on MMH agar containing 25 µg/ml spectinomycin were inoculated into 5 ml MMH broth with 25 µg/ml spectinomycin and were grown at 30°C with agitation to an optical density at 600 nm (OD600) of
0.1. Cultures of LVS were serially diluted and plated on MMH agar with no selection to quantitate the viable cells or on MMH agar with 25 µg/ml kanamycin at 41°C to select for Tn5 insertions into the F. tularensis chromosome with concomitant loss of the transposon delivery plasmid. Selection of F. tularensis Schu S4 transposition events was performed at 40°C, because the strain grew poorly at 41°C; the frequency of transposition was similar to those obtained with LVS at 41°C. F. tularensis Tn5 mutants were arrayed to 96-well cell culture plates in 100 µl MMH broth and were incubated at 37°C until turbid. Freezer stocks were made by adding 100 µl of 2x freezing medium (1.0 M sucrose, 20% glycerol).
Identification of transposon insertion sites.
To identify the sites of Tn5 insertions, genomic DNA was isolated from individual colonies and digested with EcoRI (no reporter), PciI (lux reporter), or NdeI (lacZ reporter) to create a DNA fragment containing the oriR6K origin, the aphA3 gene, and flanking chromosomal sequence. The digested DNA was ligated, transformed into a pir+ E. coli strain, and plated onto agar plates with kanamycin to select for transformants that carried the plasmid of interest. Plasmid DNA was isolated and sequenced using a primer with the sequence 5'CATGCAAGCTTCAGGGTTGAG 3' that anneals to the 3' end of the aphA3 gene and produces sequence of the flanking chromosomal DNA. Sequence data were used to search the sequenced bacterial chromosomal database, using NCBI BLAST to identify Tn5 insertion sites within the F. tularensis chromosome.
Screening lacZ and luxCDABE mutants for reporter activity.
Tn5 mutants were recovered from freezer stocks and plated on MMH agar at 37°C using a 96-prong replicator (Boekel, Feasterville, PA). After
24 h, reporter enzyme activity was detected using a 60-min exposure time with a Fujifilm LAS-1000 luminescence imager (lux reporters) or was visualized by overlaying Whatman no. 1 filter paper presoaked with 20 mg/ml X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) in dimethylformamide diluted 1:4 in water (lacZ reporters). Quantitation of lacZ activity was done according to the method of Miller (41). Duplicate cultures of tested strains were grown to mid log phase (OD600, 0.5 to 0.6) or late log phase (OD600
0.9 to 1.1), and β-galactosidase assays were performed on triplicate samples of each culture.
Cloning and expression of FLP recombinase in F. tularensis.
The gene encoding FLP recombinase was amplified from pFT-K plasmid template (45) DNA by using upstream (5'AGCAGCGGTACCCAAGGGGTGTTATGCCACAATTTGATATATTATGTAAACACC 3') and downstream (5'ATCGATCGGTCGACTTATATGCGTCTATTTATGTAGGATG 3') oligonucleotide primers. At the 5' end of the upstream primer, a Shine-Dalgarno sequence from aphA3 was included to ensure effective translation of the FLP gene in F. tularensis, and a KpnI site was included to facilitate cloning. At the 5' end of the downstream primer, a SalI site was included in the sequence of the primer. This PCR-amplified fragment was subcloned into pCR2.1 before being moved to an E. coli-Francisella shuttle vector containing the temperature-sensitive origin of replication. Expression of FLP is driven by the Francisella groES promoter. The shuttle vector containing FLP recombinase, pBB111, was introduced into Tn5 insertion mutants of Francisella strains by cryotransformation, and transformants were selected on MMH agar containing 25 µg/ml spectinomycin. Spectinomycin-resistant colonies were passaged once on MMH agar containing spectinomycin, and isolated colonies were streaked to MMH agar with or without 25 µg/ml kanamycin to screen for FLP-mediated deletion of the aphA3 gene. Southern blot confirmation of the loss of the aphA3 gene was conducted using a digoxigenin-labeled DNA probe generated using the oriR6K region of the transposon as template DNA.
|
|
|---|
Transformation/transposition and rescue of Tn5 insertions.
F. tularensis LVS was transformed with the E. coli-Francisella Tn5 transposon shuttle plasmid pBB107 by using a cryotransformation protocol (42-44). In preliminary experiments, no kanamycin-resistant colonies were obtained by directly plating transformed F. tularensis LVS and selecting at 41°C, indicating that the combined transformation and transposition frequencies were below a detectable threshold. Accordingly, the creation of transposon mutants was performed in two steps. First, transformants were selected at 30°C on plates containing spectinomycin which yielded
100 spectinomycin-resistant transformants (frequency of 1 transformant per 106 recipient bacteria). The efficiency of transformation was not significantly altered by broth or plate outgrowth (data not shown). A single spectinomycin-resistant colony was inoculated into MMH broth containing 25 µg/ml spectinomycin and grown at 30°C to an OD600 of
0.1. To determine the frequency of transposition from the pBB107 plasmid, cultures were serially diluted and plated on MMH agar with or without 25 µg/ml kanamycin at 41°C (40°C for Schu S4) to simultaneously cure the delivery plasmid and select for Tn5 insertion mutants. Our results indicated that
1 in 1,000 organisms containing pBB107 gave rise to a kanamycin-resistant Tn5 mutant (i.e., transposition frequency of 10–3) (Table 2). Fifteen kanamycin-resistant LVS mutants were randomly selected for identification of Tn5 insertion sites. Of the 15 Tn5 insertions that were recovered, each mapped to a unique location on the F. tularensis chromosome (data not shown), which is consistent with the findings of others (26, 47). This same frequency of transposition (1 x 10–3 to 4 x 10–3) has also been observed repeatedly in F. tularensis Schu S4, as part of the process of constructing various F. tularensis Schu S4 transposon libraries. Sequencing the transposon insertion site of individual mutants from these libraries revealed that the insertions are random. The Schu S4 libraries are the focus of work beyond the scope of the experiments reported in this paper. The frequency of transposition in Francisella is virtually identical to the transposition frequency observed in other bacterial species by using the Tn5 hypertransposase (24, 28). A clear advantage of making Tn5 mutants with this method over the EZ::TN transposome system is that the number of mutants that can be created in a single selection is virtually unlimited.
|
View this table: [in a new window] |
TABLE 2. Transposition frequency of Tn5 in F. tularensis
|
1-kb deletion was detected, compared to the parent strain, which corresponds to the loss of the aphA3 gene (Fig. 2).
![]() View larger version (41K): [in a new window] |
FIG. 2. FLP recombinase, expressed from a temperature-sensitive shuttle vector, deletes the kanamycin resistance gene flanked by FRT sequences. (A) Southern blot analysis of EcoRI-digested chromosomal DNA from a Tn5 insertion mutant before (lane 1) and after (lane 2) FLP-mediated deletion of the kanamycin resistance gene. The 1.0-kb loss of size in the hybridizing band is the expected deletion size. The probe used for this experiment hybridizes to the oriR6K DNA, contained in the 0.8-kb region of the chromosome as depicted in the figure. (B) Depiction of the Tn5 transposon inserted into the F. tularensis LVS chromosome. Features in gray represent the F. tularensis chromosome, while features in white represent Tn5 elements. The two black boxes represent the FRT recognition sites for FLP recombinase.
|
The activity of lux reporters in randomly generated F. tularensis strains was analyzed using a Fujifilm LAS-1000 luminescence imager. Our experimental results revealed that detection of lux activity had several technical concerns. First, the activity of bacterial luciferase, encoded by the Vibrio harveyi luxCDABE operon, was extremely low at 37°C compared with the activity of the luciferase complex at the optimal temperature of 25°C (18). This concern was magnified by the relatively low sensitivity of the photoimager, which was unable to detect the luminescence of strains grown at 37°C. These detection issues could be partially overcome by first incubating the F. tularensis lux strains at 25°C for 4 h, followed by a relatively long exposure time (1 h) in the photoimager. However, even with this relatively elaborate detection method, fewer than 1% of F. tularensis strains carrying the Tn5lux transposon insertion produced detectable luciferase activity. Despite these difficulties, we identified three strains carrying luciferase reporters that were upregulated when grown on CDM agar (Fig. 3). Sequence analysis of the transposon insertion sites in these strains revealed that the Tn5 insertions were in genes carrying a 16S rRNA (FTL_R0003), fslD (FTL_1835), and iglC (FTL_0113/1159). Quantitation of the luciferase reporter activity levels in these strains, using a luminometer, revealed significant upregulation of each of these genes when grown in CDM, although the highest level of luciferase activity was near the lower limit of detection of the luminometer.
![]() View larger version (120K): [in a new window] |
FIG. 3. F. tularensis LVS strains containing the luxCDABE reporter created by Tn5 mutagenesis. Strains containing transcriptional lux fusions in the ISFtu1 gene (control) (1), fslD (2), FTL_R0003 (3), or iglC (4) were streaked to either MMH or CDM agar and were photographed in a light field (top panels) or by use of a photoimager (bottom panels).
|
30% of the strains expressed β-galactosidase to various degrees. Of
1,500 individual mutants screened in this manner, 24 were identified as carrying lacZ reporters in genes that were differentially expressed on the two media (Fig. 4). When quantitative β-galactosidase assays were performed after growth in MMH or CDM broth to quantify gene expression, results for several strains did not match the plate-grown lacZ expression phenotypes. However, when gene expression was compared after growth in MMH versus CDM with only 350 nM FeSO4 (instead of 7 µM FeSO4), the expression profiles of broth-grown strains were found to mirror those of their plate-grown counterparts (Table 3). This finding led us to conclude that iron starvation was responsible for the observed increase in expression of at least some of the reporter strains, which was detectable on plates due to local depletion of iron around the colonies.
![]() View larger version (101K): [in a new window] |
FIG. 4. F. tularensis LVS strains containing the lacZ reporter created by Tn5 mutagenesis. Random mutants containing the lacZ reporter were arrayed to 96-well plates and were replica plated to MMH (A) or CDM (B) agar. Following 24 h of growth, plates were overlaid with filter paper presoaked in X-Gal substrate. After 20 min, a characteristic blue precipitate was observed in strains expressing lacZ. Several strains contained insertions in genes apparently causing auxotrophy for growth on CDM. Mutants that demonstrated increases in lacZ activity when grown on CDM agar were identified (box).
|
|
View this table: [in a new window] |
TABLE 3. F. tularensis LVS genes upregulated by growth on CDM
|
Expression of Fur in fsl and igl reporter strains grown in low- and high-iron media.
Since low-iron growth conditions resulted in the induction of genes in the fsl operon as well as both iglB and iglC, we examined the role of Fur in the regulation of these genes. The fur gene was PCR amplified from the F. tularensis chromosome, cloned into the E. coli-Francisella shuttle plasmid pBB110, and introduced into the fslC-lacZ and iglB-lacZ reporter strains. Since we wanted to use the iglB-lacZ reporter as an indicator of gene expression of the entire igl gene cluster, we first demonstrated that the four genes are likely transcribed as a single mRNA by using reverse transcription-PCR (RT-PCR) (Fig. 5). F. tularensis strains with lacZ reporters in fslC or iglB carrying pBB110 for expression of Fur, or without the expression vector as a control, were grown in CDM containing 28 µM (high-iron condition) or 350 nM (restricted-iron condition) FeSO4. Miller assays were conducted on the strains after growth to mid-log and late log growth phases.
![]() View larger version (27K): [in a new window] |
FIG. 5. Genes in the iglABCD cluster are operonic. (A) DNA or RNA was isolated from wild-type F. tularensis LVS, and RT-PCR was conducted using primer sets that amplified DNA spanning intragenic regions between iglA-iglB (300 bp; arrow A), iglB-iglC (350 bp; arrow B), or iglC-iglD (400 bp; arrow C). For lanes 1, 4, and 7, DNA was used as a template; for lanes 2, 5, and 8, RNA was used as a template without addition of reverse transcriptase; for lanes 3, 6, and 9, RNA was used as a template with the addition of reverse transcriptase. (B) Schematic drawing of the iglABCD gene cluster and location of primers used to amplify intragenic regions of DNA.
|
15 Miller units of activity regardless of growth phase. In contrast, the same strain showed a
5-fold increase in expression in mid-log phase and a
10-fold increase during late log phase when grown under iron-limiting conditions (Fig. 6). This result is consistent with an increase in gene expression as a result of iron depletion in the growth medium. When the fslB-lacZ reporter strain harboring the F. tularensis Fur expression plasmid was examined, it was found to exhibit little lacZ expression (<5 Miller units) when grown in high-iron media and a
10-fold reduction in activity compared to that of the parent strain when grown in iron-restricted media (Fig. 6). The observed repression of fslB by overexpression of Fur was not surprising, given the strong consensus Fur box that overlaps the predicted fsl promoter region. Similar experiments with Vibrio vulnificus demonstrated that overexpression of Fur in bacteria grown in iron-replete or -depleted media can have a repressing effect on Fur-regulated genes (33).
![]() View larger version (13K): [in a new window] |
FIG. 6. Overexpression of F. tularensis LVS fur in chromosomal lacZ reporter strains. (A) F. tularensis LVS carrying a lacZ reporter in fslC alone (parent strain; gray bars) or harboring the fur expression plasmid pBB110 (white bars) was grown to mid-log phase in CDM broth with either 28 µM (high) or 350 nM (low) FeSO4. (B) F. tularensis LVS carrying a lacZ reporter in iglB alone (parent strain; gray bars) or harboring the fur expression plasmid pBB110 (white bars) was grown to mid-log phase in CDM broth with either 28 µM (high) or 350 nM (low) FeSO4. Numbers of Miller units are averages for six independent samples.
|
200 Miller units of activity when grown in CDM broth containing a high iron concentration. When the strain was grown in iron-limiting media, we observed an
1.5-fold induction in mid log phase and a
3-fold induction in late log phase. These data are similar to those obtained from the fslC reporter, in that as iron is depleted from the growth medium, induction of iglB is increased. Unexpectedly, when we expressed the F. tularensis Fur protein in this strain we observed a modest increase in activity from the reporter in both iron-rich and iron-limiting media (Fig. 6). These results provide surprising preliminary evidence that Fur acts as a repressor for the fsl operon but not the igl operon. These data allow the possibility that Fur regulates the igl operon by a mechanism different from that of fslABCD or not at all. In fact, our findings suggest that an additional factor or factors may be responsible for repression of the igl operon genes in high iron concentrations. We intend to explore this potentially interesting regulatory mechanism in more detail. |
|
|---|
1 mutant per 108 CFU (26). Our own efforts to use the in vitro transposition system yielded small numbers of mutants per reaction that quickly consumed resources and made it difficult to obtain enough mutants for a saturating library. Combined, this information led us to create a more efficient system for creating transposon mutants of Francisella strains.
Here, we have described the construction of a Tn5 mutagenesis system that has been optimized for use with Francisella tularensis. This approach takes advantage of the hyperactive Tn5 transposase, which increases transposition
1,000-fold compared to that obtained with wild-type Tn5 (28). Transcription of the transposase gene and the kanamycin resistance gene has been placed under the control of Francisella promoters to achieve sufficient expression in Francisella strains for activity and detection. In addition, expression of the transposase gene has been placed under the control of the lac operator and LacI repressor to stabilize the transposon delivery plasmid. We have also increased the utility of the system by flanking the kanamycin resistance gene with FRT sequences to allow the creation of unmarked mutations. A key aspect of our system is the use of a temperature-sensitive F. tularensis plasmid origin of replication that was described by Maier et al. (36) as the delivery platform for the Tn5 transposon. The use of this plasmid overcomes the problem of low frequencies of plasmid transformation into F. tularensis strains because a single transformant, recovered at 30°C, can be grown to provide sufficient numbers of bacteria to obtain virtually limitless numbers of transposon mutants. Furthermore, the temperature-sensitive replicon provides a strong selection against maintenance of the plasmid, allowing mutants to be recovered with ease at 41°C. Our experimental results have validated the usefulness of this approach.
In addition to creating the Francisella Tn5 transposon mutagenesis system, we have also made two derivatives of Tn5 that create promoter fusions with luxCDABE or lacZ when inserted into the F. tularensis chromosome. The experimental data indicate that both reporters can be used to detect promoter activity in F. tularensis, although lacZ cleavage of the X-Gal substrate is much more sensitive and able to produce more consistent results than light production from the luxCDABE gene fusions. We have used strains carrying randomly inserted Tn5lacZ reporters to identify genes differentially regulated when F. tularensis is grown on MMH and CDM agar. Results from the qualitative plate screen were corroborated by Miller assays performed on broth-grown bacteria, and it was determined that iron depletion was responsible for upregulation of several genes. Among the genes found to be most highly regulated were genes in the fsl and igl operons.
The Fur protein is associated with regulation of genes that respond to iron concentration in the growth medium. Ferrous iron binds to Fur as a corepressor, causing an allosteric change in the protein that results in Fur binding to conserved nucleotide sequences which often overlap the promoter regions of Fur-regulated genes (13, 16). When iron becomes limiting, Fur adopts a non-DNA binding conformation and repression is relieved at these promoters. Fur-regulated genes are often involved in iron acquisition, but specific virulence factors in several pathogens have also been shown to be directly or indirectly regulated by Fur (34, 46). Given the strong consensus Fur box upstream of the fsl operon, it was not surprising that overexpression of F. tularensis-Fur resulted in superrepression of transcription of the fsl operon, under iron-replete growth. Interestingly, overexpression of Fur during iron-restricted growth also resulted in significant repression of the fslB-lacZ reporter. These data strongly implicate the F. tularensis Fur protein as a repressor of the fsl operon in the presence of iron.
We and others have also found that genes in the igl operon, which are essential for intracellular survival and fundamental to the virulence of this pathogen, are upregulated when F. tularensis is grown in iron-restricted medium (17, 30, 52). Deng et al. (17) proposed that a Fur box that shares 11 of 19 nucleotides with the consensus FUR box resides upstream of iglC. However, it is difficult to reconcile how a functional FUR box upstream of iglC could control iron regulation of other genes in the igl operon. To determine if Fur from F. tularensis plays a role in the regulation of iglABCD similar to that which we have observed for fslABCD, we expressed the Fur protein in an F. tularensis iglB-lacZ reporter strain. Surprisingly, overexpression of Fur in this strain resulted in a slight increase in reporter activity. While it is unclear from these experiments how Fur expression induces an increase in iglB transcription, we believe that these data clearly indicate that Fur is not acting as an iron-dependent repressor of the igl operon.
Two models are proposed to explain these data. First, F. tularensis Fur could positively regulate the expression of iglB in the absence of iron either directly, through productive contacts with RNA polymerase or by bending the DNA to favor transcription, or indirectly, through repression of a transcriptional activator elsewhere on the chromosome. A mechanism of direct activation by Fur would involve the binding of Fur upstream of the iglA promoter in the absence of iron. This model fits our data and would explain the lack of an obvious Fur box upstream of iglA. Since iron binding to Fur causes an allosteric change, the DNA binding site for Fur not bound by iron would be expected to be different from the canonical Fur-Fe consensus binding site (15). The second model holds that overexpression of Fur simply allows Fur to act as an intracellular chelator of iron, which would trigger the activation of a second iron-sensitive system that then regulates the expression of the igl operon. This model also fits our data, although the annotated LVS genome lacks an obvious alternative iron regulator.
Genetic approaches have been, and continue to be, invaluable in identifying and characterizing a wide range of bacterial characteristics, including mechanisms of pathogenesis. In particular, transposon mutagenesis and the creation of chromosomal reporters of transcriptional activity are valuable techniques for identifying bacterial virulence genes and studying their regulation. Tn5-based transposons are well characterized and widely used because of their high frequency of transposition, functionality in many gram-negative bacterial species, low sequence specificity for insertion, and stability when inserted into the host genome (14). The Tn5 transposon delivery system described in this report supplies an additional tool for work aimed at identifying and characterizing virulence factors, and their regulation, in F. tularensis strains. Our data indicate that this transposon mutagenesis system produces virtually limitless numbers of single, random, stable insertions in the chromosomes of F. tularensis strains. Modifications to the transposon provide additional features that are actively being used by our research group to explore and characterize F. tularensis pathogenesis. In addition, we have been able to demonstrate that reporters delivered by this transposon can be used to identify virulence genes (e.g., igl genes) and to study the regulation of various Francisella genes (iron regulation). Future work in our laboratory will focus on utilizing these new genetic tools to identify virulence genes and regulatory pathways that have been, until recently, inaccessible for characterization.
This work was supported by U.S. Public Health Service grant PO1 (AI044642).
Published ahead of print on 14 March 2008. ![]()
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»