Highly Selective and Rapid Arsenic Removal by Metabolically Engineered Escherichia coli Cells Expressing Fucus vesiculosus Metallothionein

An arsenic-chelating metallothionein (fMT) from the arsenic-tolerantmarine alga Fucus vesiculosus was expressed in Escherichia coli,resulting in 30- and 26-fold-higher As(III) and As(V) binding,respectively. Coexpression of the As(III)-specific transporterGlpF with fMT further improved arsenic accumulation and offeredhigh selectivity toward As. Resting E. coli cells coexpressingfMT and GlpF completely removed trace amounts (35 ppb) of As(III)within 20 min, providing a promising technology for compliancewith the As limit of 10 ppb newly recommended by the U.S. EPA.

INTRODUCTION

Top

INTRODUCTION

Arsenic (As), a metalloid, is a known human carcinogen affectingmillions of people worldwide (25, 33). Arsenic exists in twoforms: trivalent arsenite [As(III)] and pentavalent arsenate[As(V)]. Exposure to As can result in increased risks of hypertension(5, 6), skin, lung, and bladder cancers (14), and hyperkeratosis(4), due to inhibition of oxidative phosphorylation (11), interferencewith cell signaling by binding to hormone receptors (12), orgeneration of reactive oxygen species (19).

Conventional techniques for As treatment are mostly ineffectivefor the uncharged form, As(III) (9, 37), or at low arsenic concentrations.Recently, bioremediation has been gaining momentum as an environmentallyfriendly and effective alternative for removal of heavy metals(6, 7, 15, 18, 22, 26). Although metal-chelating peptides suchas metallothionein (MT) have been overexpressed in microorganismsfor enhanced accumulation of Cd and Cu, almost all such peptideslack specificity for As (1, 2, 20, 29, 31, 34, 35). Specificarsenic accumulation has been reported by utilizing the metalloregulatoryprotein ArsR (16) or phytochelatins (13, 21, 32). How-ever,enzymatic synthesis and the availability of precursors suchas glutathione and ${gamma}$ -glutamylcysteine require actively growingcells and limit the utility of the metal-chelating ArsR andphytochelatins.

Recently, a newly identified MT from an arsenic-tolerant marinealga, Fucus vesiculosus (fMT), has been cloned and stably expressedas a fusion protein (24) in Escherichia coli and has been shownto bind arsenite with high affinity in vitro (23). However,the utility of E. coli cells expressing fMT for As removal hasnot been reported. Here we report the overexpression of fMTin E. coli for enhanced accumulation of both As(V) and the unchargedform, As(III). To remove the bottleneck in As(III) uptake, theAs(III) transporter GlpF was coexpressed with fMT, resultingnot only in further improvement in As(III) accumulation butalso in selectivity for As(III). Even resting cells could removetrace amounts of As(III) within 20 min.

Expression of recombinant fMT and its effect on arsenic accumulation.

Top

Expression of recombinant fMT...

The fMT gene was constructed by annealing 11 overlapping oligonucleotides(Table 1). The resulting fragment was cloned into BamHI/PstI-digestedpUC18 to get pUC18-MT. The fMT gene was then amplified frompUC18-MT, digested with EcoRI/PstI, and ligated into similarlydigested pMALc2x (New England Biolabs), allowing the expressionof fMT as a fusion with the maltose binding protein for enhancedstability. Figure 1A shows that the fMT fusion protein was detected( $~$ 50 kDa) in E. coli strain JM109 (27) carrying pMAL-MT by sodiumdodecyl sulfate-polyacrylamide gel electrophoresis. In contrast,cells carrying pMAL-c2x produced a slightly larger band ( $~$ 54kDa) corresponding to the maltose binding protein-β-galactosidasefusion.

View this table:
[in this window]
[in a new window]

TABLE 1. Oligonucleotides used for constructing the fMT gene

View larger version (36K):
[in this window]
[in a new window]

FIG. 1. (A) Sodium dodecyl sulfate-polyacrylamide gel electrophoretic analysis of fMT expression in E. coli JM109 harboring either pMALc2x (lane 2) or pMAL-MT (lane 3). Lane 1, molecular weight marker. (B) Removal of 35 ppb of As(III) by resting E. coli strain JM109 (5 g/liter) harboring pMAL-c2x (C), pMAL-MT (MT), or pMAL-MTG (MTG). Data are means from three independent experiments. Error bars, standard deviations.

To investigate the engineered cells' ability to accumulate As,whole-cell binding experiments were conducted as described previously(16, 36). Cells expressing fMT accumulated levels of As(III)30-fold higher than those accumulated by the control (Table2), indicating that the fMT fusions retain their As(III)-bindingfunctionality in vivo. Although only direct in vitro bindingof As(III) to fMT has been demonstrated, we were interestedin the question of whether the engineered cells could affordsimilar binding for As(V). Interestingly, the MT-expressingcells also accumulated 26-fold-higher levels of As(V) (Table2), suggesting that this strain accumulates both forms of arsenicwith similar efficiencies. To decipher whether fMT could binddirectly to As(V) or whether binding requires prior reductionto As(III), a similar As(V) binding experiment was conductedwith the arsenate reductase (ArsC) deletion strain AW10 (10,17). The level of As(V) accumulation (Table 2) was 10-fold lowerthan that in JM109, indicating that arsenate reductase is primarilyresponsible for the reduction of As(V) to As(III), which subsequentlybinds to fMT. This result suggests that it may be possible tofurther improve As(V) accumulation by overexpressing arsenatereductase.

View this table:
[in this window]
[in a new window]

TABLE 2. Arsenic accumulation by bacterial cells expressing fMT and the arsenite transporter GlpF

Coexpression of MT and GlpF and its effect on As(III) accumulation.

Top

Coexpression of MT and...

To further improve overall As(III) accumulation, the As(III)transporter GlpF (3, 28) was coexpressed with fMT. The syntheticoperon was constructed by amplifying the glpF gene from pTrc10HisGlpF(Peter Agre, Duke University) using the 5'F primer CGCTGCAGCGGGAGGTCAATATGAGTCAAACATCAACCTTGAand the 3'R primer TAGTCTGCAGTTAATGGTGATGGTGATGGTGCAGCGAAGCTTTTTG(underlining identifies restriction enzyme sites; boldfacingidentifies the start codon); the glpF gene was then digestedwith PstI and ligated into pMAL-MT.

The functionality of the GlpF transporter was demonstrated byobserving a threefold enhancement in As(III) accumulation forcells overexpressing GlpF alone over that by the control strain(Table 2); coexpression of fMT and GlpF further increased thearsenic accumulation over that by cells expressing fMT alone.The level of enhancement is consistent with the observed increasein As(III) uptake due to GlpF overexpression (Table 2), reflectingthe additive effect on accumulation of coexpression of fMT andGlpF. The final level of 8.1 µmol/g (dry cell weight [DCW])is three times higher than levels recently reported for otherengineered E. coli strains (16, 30, 32).

Effects of other metals on arsenic accumulation by growing cells.

Top

Effects of other metals...

To investigate the selectivity of fMT toward As(III), bindingexperiments similar to those described above (16, 36) were performedin the presence of equimolar concentrations of other, competingmetals such as Zn, Pb, and Cd. In the presence of Pb (data notshown) or Zn (Table 2), no effect on arsenite accumulation wasobserved, suggesting that fMT has high selectivity toward As(III).However, As(III) accumulation was reduced by 56% (Table 2) inthe presence of Cd, suggesting that fMT also has high affinitywith Cd. Coexpression of GlpF with fMT increased the As(III)level by 30% in the presence of Cd (Table 2), indicating thatthe As(III)-specific transporter GlpF can be used to improvenot only As(III) uptake but also the selectivity of sequestrationby taking advantage of the transporter's selectivity towardAs(III).

Use of resting cells as As(III) biosorbents.

Top

Use of resting cells...

One potential application of the engineered strains is the useof resting cells in the absence of nutrients or antibioticsfor arsenic accumulation and removal. Cells were grown as describedabove, washed, and resuspended in prewarmed TB74S buffer (50mM Tris, 150 mM NaCl [pH 7.4]). The As(III) accumulation levelswere very similar to those achieved with growing cultures (Table2), suggesting that resting cells have the potential of beingused as active biosorbents. Interestingly, cells coexpressingfMT and GlpF showed enhancement of As(III) accumulation similarto that for growing cells, indicating that the GlpF transporteris active even in resting cells.

Since the regulatory limit for arsenic in drinking water hasrecently been lowered to 10 ppb (i.e., µg/liter) and mostchemical methods are ineffective at reducing arsenic levelsto these low concentrations, we examined the feasibility ofusing resting cells for arsenic removal at these low concentrations.At a cell concentration of 5 g (DCW)/liter, cells expressingfMT lowered the As(III) concentration from 35 ppb to 10 ppbwithin 20 min while cells expressing fMT and GlpF achieved thesame reduction within 1 min, with all the added As(III) removedwithin 20 min (Fig. 1B). In comparison, control cells reducedthe As(III) concentration only to 25 ppb, primarily due to nonspecificcell surface adsorption. This substantial improvement in Asremoval can be attributed to the enhanced uptake provided bythe additional As(III) transporter GlpF. More importantly, similarexperiments were also carried out with a fivefold excess ofCd, Zn, or Pb, and a minimal effect on As(III) removal was observed(data not shown), demonstrating that these engineered cellshave the required selectivity and affinity for As(III) removaland could be a useful biosorbent for water treatment. It isintuitive to suggest that further improvements in As accumulationcould be achieved by deleting the As(III) efflux pump (8) inorder to eliminate competition with fMT for the free As(III).

ACKNOWLEDGMENTS

This work was supported by grants from the NSF (BES0422791 andBES0329482).

Acknowledgments are due to Peter Agre, Duke University Schoolof Medicine, for providing pTrc10HisGlpF and to B. P. Rosen,Wayne State University, for providing strain AW10.

FOOTNOTES

* Corresponding author. Mailing address: Department of Chemical and Environmental Engineering, University of California, Riverside, CA 92521. Phone: (951) 827-2473. Fax: (951) 827-5696. E-mail: wilfred{at}engr.ucr.edu

Published ahead of print on 7 March 2008.

REFERENCES

Top