Previous Article | Next Article 
Applied and Environmental Microbiology, June 2009, p. 4197-4201, Vol. 75, No. 12
0099-2240/09/$08.00+0 doi:10.1128/AEM.00156-09
Copyright © 2009, American Society for Microbiology. All Rights Reserved.
The Haloprotease CPI Produced by the Moderately Halophilic Bacterium Pseudoalteromonas ruthenica Is Secreted by the Type II Secretion Pathway
,
Cristina Sánchez-Porro,1,2
Encarnación Mellado,1
Anthony P. Pugsley,2
Olivera Francetic,2 and
Antonio Ventosa1*
Department of Microbiology and Parasitology, Faculty of Pharmacy, University of Seville, Seville, Spain,1
Institut Pasteur, Unité de Génétique Moléculaire, and CNRS URA2172, Paris, France2
Received 22 January 2009/
Accepted 11 April 2009

ABSTRACT
The gene (
cpo) encoding the extracellular protease CPI produced
by the moderately halophilic bacterium
Pseudoalteromonas ruthenica CP76 was cloned, and its nucleotide sequence was analyzed. The
cpo gene encodes a 733-residue protein showing sequence similarity
to metalloproteases of the M4 family. The type II secretion
apparatus was shown to be responsible for secretion of the haloprotease
CPI.

INTRODUCTION
Moderately halophilic microorganisms include a broad variety
of bacteria that are able to grow in media containing a wide
range of elevated NaCl concentrations (3 to 15% NaCl) (
56).
Considerable attention has been focused on enzymes of moderately
halophilic bacteria, since they have substantial biotechnological
potential (
29,
56). While several proteases from extreme halophiles,
members of the halophilic archaea, have been characterized (
12,
15,
19,
36,
44,
49,
50,
51,
57), fewer proteases from moderately
halophilic bacteria have been purified and studied in depth
(
9,
14,
18,
20,
21,
33).
The moderately halophilic bacterium Pseudoalteromonas ruthenica CP76 was isolated from a saltern located in Isla Cristina (Huelva, Spain). This strain was selected for its ability to produce an extracellular protease, haloprotease CPI, which has a molecular mass of 38.0 kDa (46, 47). The haloprotease CPI was purified and biochemically characterized. It showed optimal activity at 55°C and pH 8.5 and tolerated a wide range of NaCl concentrations (0 to 4 M NaCl). In this work, we describe the molecular characterization of the operon encoding the haloprotease CPI and a second protease, CPII. We also report the first study of the mechanism used for the secretion of haloprotease CPI to the extracellular medium.
The N-terminal amino acid sequence of the haloprotease CPI (ADATGPGGNQKTGQYNY) (47) allowed us to identify several homologues of CPI in a BLAST search (1). We aligned (16, 53) metalloproteases from Vibrio, Aeromonas, or Pseudomonas species (3, 6, 23, 30). On the basis of the conserved regions, degenerate PCR primers AminoProL (GGYCCWGGYGGYAAYCAAAAR) and ProR (CCNGNATRTCHGARAANGCTTC) were designed. We first amplified a 500-bp DNA fragment from the total DNA (27) of P. ruthenica CP76, which was then used in two rounds of inverse PCR (37) to obtain a 4,680-bp fragment. Two open reading frames (ORFs) were found in this fragment (Fig. 1A). The first of them, cpo (2,202 bp), starts at position 148 and ends at position 2,349, encoding a polypeptide of 733 amino acids with an estimated molecular mass of 78.8 kDa. The mature secreted CPI protease corresponded to residues Ala-212 to Lys-542 of the cpo gene product, on the basis of its N-terminal sequence and molecular mass (38.0 kDa) (47). A BLAST analysis of the protein sequence deduced from cpo against the NCBI CDD database (26) revealed that the gene encodes a modular enzyme consisting of four domains: the signal sequence (28 amino acids); the N-terminal proregion (183 amino acids); the mature protease region (331 amino acids) of the M4 superfamily, with two distinct N-terminal and C-terminal domains; and the C-terminal prodomain (191 amino acids). The mature protease region of CPI showed sequence homology to metalloproteases belonging to the zincins superfamily (peptidase M4), such as EmpI from Pseudoalteromonas sp. strain A28 (69% identity) (25) or the metalloprotease MprI from Alteromonas sp. strain 0-7 (66% identity) (31). The mature protease has the highly conserved HEXXH zinc-binding motif (HEVSH) that is characteristic of this protease family (32). In the thermolysin family, another conserved amino acid sequence (the third zinc ligand motif, GXXNEXXSD) is generally found together with the HEXXH motif. The motif GGLNAFSD, comprised of residues Gly-372 to Asp-380, was also found in the protease CPI (see Fig. S1 in the supplemental material).
The
cpo gene encodes a precursor protein with a molecular mass
of 78.8 kDa. However, the haloprotease CPI has been purified
as a biologically active enzyme with a molecular mass of only
38.0 kDa (
47). This indicates that, upon removal of the signal
peptide, the protein is proteolytically processed upstream of
His-211, delineating a proregion commonly found in the microbial
proteases (
32). The size of the remaining polypeptide (522 amino
acids) is about 55.7 kDa, indicating that the C-terminal propeptide
containing the two bacterial prepeptidase C-terminal (PPC) domains
is also removed by proteolytic processing. Other extracellular
bacterial proteases undergo similar proteolytic processing (
28);
for example, it has been suggested that the zinc metalloprotease
from the halophilic bacterium
Salinivibrio sp. strain AF-2004
also undergoes both N- and C-terminal processing (
21).
ORF2, designated cpt (positions 2409 to 4258), encodes a protein of 614 amino acids with a predicted molecular mass of 65.9 kDa. A putative Shine-Dalgarno sequence, GGGAG, was found 7 bp upstream from the start codon (ATG) of the cpo gene. Analysis of the sequence upstream of the cpo initiation codon allowed us to identify a putative promoter region, with TTGGAG for the –35 and TATTAG for the –10 sequence, respectively. A putative transcriptional terminator is found 17 bp downstream from the cpt stop codon. The cpt gene encodes a protein with high similarity to M28 metalloproteases, such as the aminopeptidase from Vibrio cholerae (40% identity) (13), leucyl aminopeptidase from Vibrio proteolyticus (41% identity) (54), and the metalloprotease MprII from Alteromonas O-7 (58% identity) (31). The cpt gene product is synthesized with a Sec-type signal peptide of 21 residues. Its catalytic domain, belonging to the aminopeptidase M28 family, is followed by the C-terminal prodomain containing two PPC domains, very similar to those found in CPI. These C-terminal polypeptides are found in various proteases produced by gram-negative bacteria. The PPC domains could be necessary for the correct folding, secretion, or maintenance of the proteases in an inactive form inside cells and are removed upon secretion (5, 22, 35).
To test whether the cpo and cpt genes constitute an operon, we carried out reverse transcription-PCR assays with primers based on their intergenic-region sequences. RNA was extracted from exponential-phase cultures of P. ruthenica CP76 with an RNeasy mini kit (Qiagen) and was treated with DNase I (Amersham Biosciences). Retrotranscription was performed using a Transcriptor first strand cDNA synthesis kit with random hexamer primers (Roche). The PCRs were performed using 35 cycles of 1 min at 94°C, 30 s at 53°C, and 45 s at 72°C (45). Three pairs of primers were designed: RT-PCR1F (CCAAGCGATGACCTTCGG) and RT-PCR2R (CTTTTGTGTATCCCAGCCGC) were designed on the basis of the region upstream of cpo (288 bp), RT-PCR3F (GTTCGCAATCAACCACCAGC) and RT-PCR4R (GTGCATAAAGTCGCTTAGGCG) were designed on the basis of the region upstream of cpo and the region downstream of cpt (448 bp), and RTPCR5F (GAGGAAGTGGGACTCAGAGGC) and RTPCR6R (GAGCTCGTTATCACTCGGTGG) were designed according to the region downstream of cpt (444 bp). A product of the expected size, 448 bp, corresponding to the intergenic region between cpo and cpt, was amplified. These results confirmed that cpo and cpt are transcribed as a single transcriptional unit. The MprI and MprII proteases (31), homologues to CPI and CPII, respectively, are translated from an operon with the same genetic organization as that of the cpo-cpt operon of P. ruthenica CP76. This suggests that these enzymes have a common regulation mechanism, secretion pathway, and complementary function in bacterial physiology.
Little is known about protein secretion in halophilic bacteria. A wide spectrum of gram-negative bacteria utilize the type II secretion pathway for extracellular release of proteins, such as hydrolytic enzymes and toxins (39). Since the CPI precursor is synthesized with an N-terminal signal peptide, we hypothesized that the type II secretion pathway is used to secrete CPI. Some of the most highly conserved components of the type II secretion machineries are the secretins of the PulD family (2). We designed degenerate oligonucleotide primers WmpDL (GTCGCTGATGAGCGTACCAAT) and WmpDR (TGATACTTCTTGCTCAAT) on the basis of sequence alignments of PulD homologues from several gram-negative bacteria (1, 7, 10, 13, 17, 22, 42, 52). We amplified a 912-bp fragment from the P. ruthenica CP76 total DNA, corresponding to a fragment of a secretin gene, which we designated wmpD. Using an inverse PCR strategy, we amplified and cloned a 3,897-bp DNA fragment corresponding to the DNA for the PulD-type secretin from P. ruthenica CP76. Sequencing of this fragment revealed the presence of one complete and two partial consecutive ORFs in the same orientation. The first ORF showed homology to genes in the pulC family (encoding type II secretion component protein C) and was therefore designated wmpC. The second ORF, designated wmpD, encodes a 688-amino-acid protein with a molecular mass of 74.8 kDa that is highly similar to the secretin D of several type II secretion systems. The third ORF, designated wmpE, encodes a polypeptide with the highest identity scored for the type II secretion component PulE (40, 48).
To assess the involvement of the type II secretion pathway in the secretion of the extracellular enzymes of P. ruthenica CP76, the wmpD gene was disrupted by the insertion of an
(Smr) interposon (38) in plasmid pPD2 and subcloned into the suicide vector pJQSK200 (Gmr) (41). The mutation was transferred by a double-recombination event to the chromosome of the wild-type strain by triparental mating using pRK600 (Cmr) as the helper plasmid (55). The recombinant exconjugants were identified as Smr Rfr Gms colonies on SW2 plates (47) containing 10% sucrose. The correct insertion of the
(Smr) cassette in the chromosomal wpmD gene was checked by PCR, and the wmpD::
Sm mutant was designated P. ruthenica CP77. The qualitative assay, carried out by performing a modified version of the method of Kunitz (24) on SW10 skim milk plates (Fig. 2A), revealed that P. ruthenica CP77 is unable to secrete active CPI haloprotease. The periplasmic and cytoplasmic fractions were obtained by osmotic shock applied to the cells according to the method of Neu and Heppel (34). P. ruthenica CP77 showed 6% of the protease activity in the extracellular fraction seen in the parent strain. In contrast, upon cell disruption, P. ruthenica CP77 exhibited 34% and 42% protease activities in the periplasmic and cytoplasmic fractions, respectively, relative to the levels in the parent strain, whereas P. ruthenica CP76 only showed trace activities in these fractions (Fig. 2B). Thus, P. ruthenica CP77 does not secrete the protease and shows increased intracellular protease accumulation. This finding indicates that the type II secretion components transfer the haloprotease CPI across the outer membrane. In addition, CPI secretion by the type II pathway is required for its proteolytic activation.
Here we show that the haloprotease CPI from
P. ruthenica CP76
is secreted by the type II secretion apparatus via its dependence
on secretin D, the secretion portal of this system (
4). The
family of PulD proteins comprises several membrane-associated
proteins that are essential for transport of macromolecules
across bacterial envelope. Amino acid sequence analysis revealed
a possible modular organization of proteins of this superfamily,
with highly conserved C-terminal domains and dissimilar N-terminal
domains. In the C-terminal domain, four highly conserved regions
have been found, one of them containing a remarkable common
motif: (V,I)PXL(S,G)XIPXXGXLF (
11). These four regions and the
highly conserved motif have been found in
P. ruthenica CP76.
In
P. ruthenica CP76, the gene for this protein,
wmpD, is flanked
by
wmpC and
wmpE, as is often the case in other bacteria.
It appears, therefore, that the type II secretion system is well adapted to cope with the extreme conditions under which the bacterium P. ruthenica CP76 grows (concentrations of NaCl as low as 0.5% NaCl and as high as 17.5% NaCl). It would be of interest to identify specific features of the type II secretion system and its substrates that are linked to the ionic-strength conditions inside or outside the cells. The absence of extracellular protease activity in the wmpD mutant suggests that not only CPI but also the CPII protease may be secreted by the same pathway. This study raises a number of questions about the mechanisms of adaptation of the proteins of halophilic bacteria. While the halophilic archaea use the twin-arginine translocation (Tat) pathway for protein secretion (8, 43), the moderately halophilic gram-negative bacterium described in this work exports the haloprotease CPI to the medium using the two-step pathway. Similar to the twin-arginine pathway, the type II secretion system allows secretion of substrates that are prefolded, in this case usually in the oxidative periplasmic compartment. It would be interesting to determine if the metalloprotease produced by Salinivibrio sp. strain AF-2004 (21) uses the same pathway and whether the type I secretion system, which secretes protein in an unfolded state, functions in moderately halophilic bacteria.

Nucleotide sequence accession numbers.
The nucleotide sequences reported in this paper have been submitted
to the EMBL/GenBank/DDBJ database and assigned accession numbers
FM863706 for the
cpo gene, FM863707 for the
cpt gene, and FM863708
for the
wmpD gene.

ACKNOWLEDGMENTS
We thank Dominique Vidal-Ingigliardi for help with the protein
sequence alignments of type II secretion system components.
This work was supported by grants from the Spanish Ministerio de Ciencia y Tecnología (BIO-2006-06927 and CTM2006-03310) and Junta de Andalucía (P06-CVI-01829). Cristina Sánchez-Porro was supported by a fellowship from the Spanish Ministerio de Ciencia y Tecnología. She acknowledges the two short-term fellowships for the Ministerio de Ciencia y Tecnología that permitted her to work at the Institut Pasteur.

FOOTNOTES
* Corresponding author. Mailing address: Department of Microbiology and Parasitology, Faculty of Pharmacy, University of Seville, 41012 Seville, Spain. Phone: 34 95 455 6765. Fax: 34 95 462 8162. E-mail:
ventosa{at}us.es 
Published ahead of print on 17 April 2009. 
Supplemental material for this article may be found at http://aem.asm.org/. 

REFERENCES
1 - Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
2 - Bayan, N., I. Guilvout, and A. P. Pugsley. 2006. Secretins take shape. Mol. Microbiol. 60:1-4.[CrossRef][Medline]
3 - Bever, R. A., and B. H. Iglewski. 1988. Molecular characterization and nucleotide sequence of the Pseudomonas aeruginosa elastase structural gene. J. Bacteriol. 170:4309-4314.[Abstract/Free Full Text]
4 - Chami, M., I. Guilvout, M. Gregorini, H. W. Rémigy, S. A. Müller, M. Valerio, A. Engel, A. P. Pugsley, and N. Bayan. 2005. Structural insights into the secretin PulD and its trypsin-resistant core. J. Biol. Chem. 280:37732-37741.[Abstract/Free Full Text]
5 - Chuang, Y. C., T. M. Chang, and M. C. Chang. 1997. Cloning and characterization of the gene (empV) encoding extracellular metalloprotease from Vibrio vulnificus. Gene 189:163-168.[CrossRef][Medline]
6 - David, V. A., A. H. Deutch, A. Sloma, D. Pawlyk, A. Ally, and D. R. Durham. 1992. Cloning, sequencing and expression of the gene encoding the extracellular neutral protease, vibriolysin, of Vibrio proteolyticus. Gene 112:107-112.[CrossRef][Medline]
7 - d'Enfert, C., I. Reyss, C. Wandersman, and A. P. Pugsley. 1989. Protein secretion by Gram-negative bacteria. Characterization of two membrane proteins required for pullulanase secretion by Escherichia coli K-12. J. Biol. Chem. 264:17462-17468.[Abstract/Free Full Text]
8 - Dilks, K., M. I. Giménez, and M. Pohlschröder. 2005. Genetic and biochemical analysis of the twin-arginine translocation pathway in halophilic archaea. J. Bacteriol. 187:8104-8113.[Abstract/Free Full Text]
9 - Dodia, M. S., C. M. Rawal, H. G. Bhimani, R. H. Joshi, S. K. Khare, and S. P. Singh. 2008. Purification and stability characteristics of an alkaline serine protease from a newly isolated haloalkaliphilic bacterium sp. AH-6. J. Ind. Microbiol. Biotechnol. 35:121-131.[CrossRef][Medline]
10 - Egan, S., S. James, C. Holmstrom, and S. Kjelleberg. 2002. Correlation between pigmentation and antifouling compounds produced by Pseudoalteromonas tunicata. Environ. Microbiol. 4:433-442.[CrossRef][Medline]
11 - Genin, S., and C. A. Boucher. 1994. A superfamily of proteins involved in different secretion pathways in Gram-negative bacteria: modular structure and specificity of the N-terminal domain. Mol. Gen. Genet. 243:112-118.[CrossRef][Medline]
12 - Giménez, M. I., C. A. Studdert, J. J. Sánchez, and R. E. De Castro. 2000. Extracellular protease of Natrialba magadii: purification and biochemical characterization. Extremophiles 4:181-188.[Medline]
13 - Heidelberg, J. F., J. A. Eisen, W. C. Nelson, R. A. Clayton, M. L. Gwinn, R. J. Dodson, D. H. Haft, E. K. Hickey, J. D. Peterson, L. Umayam, S. R. Gill, K. E. Nelson, T. D. Read, H. Tettelin, D. Richardson, M. D. Ermolaeva, J. Vamathevan, S. Bass, H. Qin, I. Dragoi, P. Sellers, L. McDonald, T. Utterback, R. D. Fleishmann, W. C. Nierman, O. White, S. L. Salzberg, H. O. Smith, R. R. Colwell, J. J. Mekalanos, J. C. Venter, and C. M. Fraser. 2000. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406:477-483.[CrossRef][Medline]
14 - Hiraga, K., Y. Nishikata, S. Namwong, S. Tanasupawat, K. Takada, and K. Oda. 2005. Purification and characterization of serine proteinase from a halophilic bacterium, Filobacillus sp. RF2-5. Biosci. Biotechnol. Biochem. 69:38-44.[CrossRef][Medline]
15 - Izotova, L. S., A. Y. Strongin, L. N. Chekulaeva, V. E. Sterkin, V. I. Ostoslavskaya, L. A. Lyublinskaya, E. A. Timokhina, and V. M. Stepanov. 1983. Purification and properties of serine protease from Halobacterium halobium. J. Bacteriol. 155:826-830.[Abstract/Free Full Text]
16 - Jeanmougin, F., J. D. Thompson, M. Gouy, D. G. Higgins, and T. J. Gibson. 1998. Multiple sequence alignment with Clustal X. Trends Biochem. Sci. 23:403-405.[CrossRef][Medline]
17 - Jiang, B., and S. P. Howard. 1992. The Aeromonas hydrophila exeE gene, required both for protein secretion and normal outer membrane biogenesis, is a member of a general secretion pathway. Mol. Microbiol. 6:1351-1361.[CrossRef][Medline]
18 - Kamekura, M., and H. Onishi. 1974. Protease formation by a moderately halophilic Bacillus strain. Appl. Microbiol. 27:809-810.[Medline]
19 - Kamekura, M., Y. Seno, M. L. Holmes, and M. L. Dyall-Smith. 1992. Molecular cloning and sequencing of the gene for a halophilic alkaline serine protease (halolysin) from an unidentified halophilic archaea strain (172P1) and expression of the gene in Haloferax volcanii. J. Bacteriol. 174:736-742.[Abstract/Free Full Text]
20 - Karbalaei-Heidari, H. R., M. A. Amoozegar, M. Hajighasemi, A. A. Ziaee, and A. Ventosa. 2009. Production, optimization and purification of a novel extracellular protease from the moderately halophilic bacterium Halobacillus karajensis. J. Ind. Microbiol. Biotechnol. 36:21-27.[CrossRef][Medline]
21 - Karbalaei-Heidari, H. R., A. A. Ziaee, M. A. Amoozegar, Y. Cheburkin, and N. Budisa. 2008. Molecular cloning and sequence analysis of a novel zinc-metalloprotease gene from the Salinivibrio sp. strain AF-2004 and its extracellular expression in E. coli. Gene 408:196-203.[CrossRef][Medline]
22 - Karlyshev, A. V., and S. MacIntyre. 1995. Cloning and study of the genetic organization of the exe gene cluster of Aeromonas salmonicida. Gene 158:77-82.[CrossRef][Medline]
23 - Kawakami, K., C. Toma, and Y. Honma. 2000. Cloning, sequencing and expression of the gene encoding the extracellular metalloprotease of Aeromonas caviae. Microbiol. Immunol. 44:341-347.[Medline]
24 - Kunitz, M. 1947. Crystalline soybean trypsin inhibitor. II. General properties. J. Gen. Physiol. 30:291-310.[Abstract/Free Full Text]
25 - Lee, S. O., J. Kato, K. Nakashima, A. Kuroda, T. Ikeda, N. Takiguchi, and H. Ohtake. 2002. Cloning and characterization of extracellular metal protease gene of the algicidal marine bacterium Pseudoalteromonas sp. strain A28. Biosci. Biotechnol. Biochem. 66:1366-1369.[CrossRef][Medline]
26 - Marchler-Bauer, A., J. B. Anderson, M. K. Derbyshire, C. DeWeese-Scott, N. R. Gonzales, M. Gwadz, L. Hao, S. He, D. I. Hurwitz, J. D. Jackson, Z. Ke, D. Krylov, C. J. Lanczycki, C. A. Liebert, C. Liu, F. Lu, S. Lu, G. H. Marchler, M. Mullokandov, J. S. Song, N. Thanki, R. A. Yamashita, J. J. Yin, D. Zhang, and S. H. Bryant. 2007. CDD: a conserved domain database for interactive domain family analysis. Nucleic Acids Res. 35(Database issue):D237-D240.[Abstract/Free Full Text]
27 - Marmur, J. 1961. A procedure for the isolation of deoxyribonucleic acid from micro-organisms. J. Mol. Biol. 3:208-218.
28 - McIver, K. S., E. Kessler, and D. E. Oman. 2004. Identification of residues in the Pseudomonas aeruginosa elastase propeptide required for chaperone and secretion activities. Microbiology 150:3969-3977.[Abstract/Free Full Text]
29 - Mellado, E., and A. Ventosa. 2003. Biotechnological potential of moderately and extremely halophilic microorganisms, p. 233-256. In J. L. Barredo (ed.), Microorganisms for health care, food and enzyme production. Research Signpost, Kerala, India.
30 - Milton, D. L., A. Norqvist, and H. Wolf-Watz. 1992. Cloning of a metalloprotease gene involved in the virulence mechanism of Vibrio anguillarum. J. Bacteriol. 174:7235-7244.[Abstract/Free Full Text]
31 - Miyamoto, K., H. Tsujibo, E. Nukui, H. Itoh, Y. Kaidzu, and Y. Inamori. 2002. Isolation and characterization of the genes encoding two metalloproteases (MprI and MprII) from a marine bacterium, Alteromonas sp. strain O-7. Biosci. Biotechnol. Biochem. 66:416-421.[CrossRef][Medline]
32 - Miyoshi, S., and S. Shinoda. 2000. Microbial metalloproteases and pathogenesis. Microbes Infect. 2:91-98.[CrossRef][Medline]
33 - Namwong, S., K. Hiraga, K. Takada, M. Tsunemi, S. Tanasupawat, and K. Oda. 2006. A halophilic serine proteinase from Halobacillus sp. SR5-3 isolated from fish sauce: purification and characterization. Biosci. Biotechnol. Biochem. 70:1395-1401.[CrossRef][Medline]
34 - Neu, H. C., and L. A. Heppel. 1965. The release of enzymes from Escherichia coli by osmotic shock and during the formation of spheroplasts. J. Biol. Chem. 240:3685-3692.[Free Full Text]
35 - Nirasawa, S., Y. Nakajima, Z. Zhang, M. Yoshida, and K. Hayashi. 1999. Molecular cloning and expression in Escherichia coli of the extracellular endoprotease of Aeromonas caviae T-64, a pro-aminopeptidase processing enzyme. Biochim. Biophys. Acta 1433:335-342.[CrossRef][Medline]
36 - Norberg, P., and B. Von Hofsten. 1969. Proteolytic enzymes from extremely halophilic bacteria. J. Gen. Microbiol. 55:251-256.[Abstract/Free Full Text]
37 - Ochman, H., A. S. Gerber, and D. L. Hartl. 1988. Genetic applications of an inverse polymerase chain reaction. Genetics 120:621-623.[Abstract/Free Full Text]
38 - Prentki, P., and H. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313.[CrossRef][Medline]
39 - Pugsley, A. P. 1993. The complete general secretory pathway in gram-negative bacteria. Microbiol. Rev. 57:50-108.[Abstract/Free Full Text]
40 - Pugsley, A. P., O. Francetic, O. M. Possot, N. Sauvonnet, and K. R. Hardie. 1997. Recent progress and future directions in studies of the main terminal branch of the general secretory pathway in Gram-negative bacteria—a review. Gene 192:13-19.[CrossRef][Medline]
41 - Quandt, J., and M. F. Hynes. 1993. Versatile suicide vectors which allow direct selection for gene replacement in gram-negative bacteria. Gene 127:15-21.[CrossRef][Medline]
42 - Reeves, P. J., D. Whitcombe, S. Wharam, M. Gibson, G. Allison, N. Bunce, R. Barallon, P. Douglas, V. Mulholland, S. Stevens, D. Walker, and G. P. C. Salmond. 1993. Molecular cloning and characterization of 13 out genes from Erwinia carotovora subspecies carotovora: genes encoding members of a general secretion pathway (GSP) widespread in Gram-negative bacteria. Mol. Microbiol. 8:443-456.[CrossRef][Medline]
43 - Rose, R. W., T. Brüser, J. C. Kissinger, and M. Pohlschröder. 2002. Adaptation of protein secretion to extremely high-salt conditions by extensive use of the twin-arginine translocation pathway. Mol. Microbiol. 45:943-950.[CrossRef][Medline]
44 - Ryu, K., J. Kim, and J. S. Dordick. 1994. Catalytic properties and potential of an extracellular protease from an extreme halophile. Enzyme Microbiol. Technol. 16:266-275.[CrossRef][Medline]
45 - Sambrook, J., and D. W. Russell (ed.). 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
46 - Sánchez-Porro, C., S. Martín, E. Mellado, and A. Ventosa. 2003. Diversity of moderately halophilic bacteria producing extracellular hydrolytic enzymes. J. Appl. Microbiol. 94:295-300.[CrossRef][Medline]
47 - Sánchez-Porro, C., E. Mellado, C. Bertoldo, G. Antranikian, and A. Ventosa. 2003. Screening and characterization of the protease CPI produced by the moderately halophilic bacterium Pseudoalteromonas sp. strain CP76. Extremophiles 7:221-228.[Medline]
48 - Sandkvist, M. 2001. Biology of type II secretion. Mol. Microbiol. 40:271-283.[CrossRef][Medline]
49 - Shi, W., X. F. Tang, Y. Huang, F. Gan, B. Tang, and P. Shen. 2006. An extracellular halophilic protease SptA from a halophilic archaeon Natrinema sp. J7: gene cloning, expression and characterization. Extremophiles 10:599-606.[CrossRef][Medline]
50 - Stepanov, V. M., G. N. Rudenskaya, L. P. Revina, Y. B. Gryaznova, E. N. Lysogorskaya, I. Y. U. Filippova, and I. I. Ivanova. 1992. A serine proteinase of an archaebacterium, Halobacterium mediterranei. A homologue of eubacterial subtilisins. Biochem. J. 285:281-286.[Medline]
51 - Studdert, C. A., M. K. Herrera Seitz, M. I. Plasencia Gil, J. J. Sanchez, and R. E. de Castro. 2001. Purification and biochemical characterization of the haloalkaliphilic archaeon Natronococcus occultus extracellular serine protease. J. Basic Microbiol. 41:375-383.[CrossRef][Medline]
52 - Tauschek, M., R. J. Gorrell, R. A. Strugnell, and R. M. Robins-Browne. 2002. Identification of a protein secretory pathway for the secretion of heat-labile enterotoxin by an enterotoxigenic strain of Escherichia coli. Proc. Natl. Acad. Sci. USA 99:7066-7071.[Abstract/Free Full Text]
53 - Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
54 - Van Heeke, G., S. Denslow, J. R. Watkins, K. J. Wilson, and F. W. Wagner. 1992. Cloning and nucleotide sequence of the Vibrio proteolyticus aminopeptidase gene. Biochim. Biophys. Acta 1131:337-340.[Medline]
55 - Vargas, C., M. J. Coronado, A. Ventosa, and J. J. Nieto. 1997. Host range, stability, and compatibility of broad host-range-plasmids and a shuttle vector in moderately halophilic bacteria. Evidence of intragenic and intergenic conjugation in moderate halophiles. Syst. Appl. Microbiol. 20:173-181.
56 - Ventosa, A., J. J. Nieto, and A. Oren. 1998. Biology of moderately halophilic aerobic bacteria. Microbiol. Mol. Biol. Rev. 62:504-544.[Abstract/Free Full Text]
57 - Vidyasagar, M., S. B. Prakash, and K. Sreeramulu. 2006. Optimization of culture conditions for the production of haloalkaliphilic thermostable protease from an extremely halophilic archaeon Halogeometricum sp. TSS101. Lett. Appl. Microbiol. 43:385-391.[CrossRef][Medline]
Applied and Environmental Microbiology, June 2009, p. 4197-4201, Vol. 75, No. 12
0099-2240/09/$08.00+0 doi:10.1128/AEM.00156-09
Copyright © 2009, American Society for Microbiology. All Rights Reserved.