Previous Article | Next Article ![]()
Applied and Environmental Microbiology, February 2009, p. 629-636, Vol. 75, No. 3
0099-2240/09/$08.00+0 doi:10.1128/AEM.02111-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.
,
*
Takumi Satoh,
Mitsunori Todoroki, and
Youichi Niimura
Department of Biosciences, Tokyo University of Agriculture, Setagaya-ku, Tokyo 156-8502, Japan
Received 11 September 2008/ Accepted 28 November 2008
|
|
|---|
|
|
|---|
The genus Bifidobacterium contains probiotic species beneficial for the human intestine, but its sensitivity to O2 decreases its viability during the stages of food processing, storage, and incorporation into the human intestine (42, 45). Several approaches have been taken to determine the mechanisms of bifidobacterial aerobic growth inhibition (10, 21, 43). de Vries and Stouthamer proposed that O2-sensitive Bifidobacterium species produce H2O2 through the reaction of NADH oxidase detected in cell extracts (10); however, the molecular-level mechanisms of growth inhibition and H2O2 production have since remained essentially unknown.
In our previous study, we classified Bifidobacterium species into oxygen-sensitive species and microaerophilic species (21, 22). Many species belonging to the genus Bifidobacterium show oxygen-sensitive growth profiles under highly aerated conditions (21). These species grow in liquid medium when shaken under 5% O2 conditions, but growth is inhibited under 10 to 20% O2 conditions with an accumulation of H2O2, and growth is recovered when they are cultured in the presence of exogenously added catalase. Microaerophilic species such as B. boum and B. thermophilum grow well even under 20% O2 and do not accumulate H2O2 (21). These observations indicate that the production of H2O2 is the primary reason for bifidobacterial aerobic growth inhibition. Two main theories, the existence of H2O2 production systems and the lack of H2O2 detoxification systems, have been proposed for O2-sensitive Bifidobacterium species. As to systems to reduce O2 to H2O2, only NADH oxidase activities have been detected in the cell extracts of all tested bifidobacterial species (21). Although the total NADH-dependent oxidase activities in cell extracts are similar among species, the type of NADH oxidase activity differs between O2-sensitive and microaerophilic species: O2-sensitive species show H2O2-forming activity, and microaerophilic species show H2O-forming activity (21).
In this study, we purified and characterized a protein that exhibits H2O2-forming NADH oxidase activity from an O2-sensitive species, Bifidobacterium bifidum, the type species of the genus Bifidobacterium (15). B. bifidum possesses a dominant active fraction and a minor active fraction of NADH oxidase activity during purification. The purified protein from the major active fraction is a homologue of b-type dihydroorotate (DHO) dehydrogenase (DHOD; EC 1.3.1.14, EC 1.3.3.1, EC 1.3.99.11), the enzyme that catalyzes the oxidation of DHO to orotate in pyrimidine biosynthesis (35). Previously, many enzymes that function as NADH oxidase in vivo have been purified and characterized; however, to our knowledge, no DHOD has been purified as a main source of NADH oxidase activity in cell extracts. The kinetics of the purified enzyme was studied to determine the functionality of its DHOD reaction, as well as its H2O2-forming NADH oxidase reaction.
|
|
|---|
Chemicals.
All chemicals were of analytical grade. Orotic acid, DHO, ß-NADH, ß-NAD+, fumarate, cytochrome c, 2,3-dimethoxy-5-methyl-1,4-benzoquinone (Q0), ubiquinone 10 (Q10), menadione, and 2,6-dichlorobenzenoneindophenol (DCIP) were from Sigma. Water was prepared with an Ellix-10 Milli-Q ultrapure water system (Millipore, Tokyo, Japan).
Enzyme purification.
NADH oxidase activity was assayed spectrophotometrically in 1 ml of air-saturated 50 mM potassium phosphate buffer (pH 6.5) containing 0.15 mM NADH at 37°C. The reaction was started by the addition of enzyme solution, and the decrease in absorbance at 340 nm (
340 = 6,220 M–1 cm–1) was monitored with a spectrophotometer (HITACHI U-3300; Hitachi, Japan). One unit of activity was defined as the amount of enzyme that catalyzes the oxidation of 1 µmol NADH per min.
Microaerobically grown B. bifidum cells (80 g) were suspended in 240 ml of 50 mM potassium phosphate buffer, pH 6.5, containing 0.1 mM DTT, 0.2 mM phenylmethylsulfonyl fluoride (PMSF), and 5 mM EDTA, and then the cells were disrupted by treatment with a French pressure cell at 140 MPa. All purification procedures were carried out at 4°C or on ice. Cell-free extracts (CFE) were obtained by removing cell debris by centrifugation at 39,000 x g for 15 min. The cytoplasmic solution obtained by ultracentrifugation at 100,000 x g for 2 h was treated with 10% streptomycin sulfate (dissolved in 10 mM potassium phosphate buffer, pH 7.1) to remove nucleic acids. After centrifugation at 39,000 x g for 15 min, the supernatant was fractionated by the stepwise addition of solid ammonium sulfate (20%). The supernatant obtained after centrifugation at 30,000 x g was dissolved in 50 mM potassium phosphate buffer, pH 7.0, containing 1 M ammonium sulfate, 5 mM EDTA, 0.2 mM PMSF, and 0.1 mM dithiothreitol (DTT). After centrifugation at 39.000 x g for 15 min, the supernatant was subjected to Butyl-Toyopearl 650S (Tosoh, Tokyo, Japan) column chromatography. The enzyme was eluted with a linear gradient of 800 to 0 mM ammonium sulfate dissolved in the same buffer. After Butyl-Toyopearl chromatography, two main fractions of NADH oxidase activity were obtained. The major active fractions were collected and further purified. The solution after Butyl-Toyopearl chromatography was dialyzed against 50 mM potassium phosphate buffer, pH 6.5, containing 0.5 mM EDTA, 0.2 mM PMSF, 0.1 mM DTT, and 25 µM flavin adenine dinucleotide (FAD) for 6 h, and this procedure was repeated three times with freshly prepared buffer each time. The enzyme solution was then subjected to DEAE-Sephacel (Amersham-Pharmacia, Japan) column chromatography. The column was sequentially washed with the same buffer containing 0 and 150 mM NaCl and eluted with buffer containing 220 mM NaCl. The active fractions were pooled and dialyzed for 12 h against 10 mM potassium phosphate buffer, pH 6.5, containing 0.5 mM EDTA, 0.1 mM DTT, and 25 µM FAD and subjected to hydroxyapatite (Wako, Japan) column chromatography. After the enzyme solution was applied to the hydroxyapatite column, the protein was sequentially washed with 10 and 50 mM potassium phosphate buffer, pH 6.5, and eluted with 100 mM potassium phosphate buffer, pH 6.5. The active fractions were collected and concentrated with Amicon Ultra (30,000-Da cutoff; Millipore, Cork, Ireland). The concentrated enzyme was subjected to POLOS HQ/H (PerSeptive Biosystems, Framingham, MA) column chromatography. The column was sequentially washed with 50 mM potassium phosphate buffer, pH 6.5, containing 0 M NaCl (stepwise) and 0 mM to 100 mM NaCl (linear gradient) and then eluted with a linear gradient of 100 to 250 mM NaCl. The active fraction was collected and concentrated with Amicon Ultra. After this chromatography, the enzyme purity in the active fractions was checked by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with Coomassie brilliant blue staining or silver staining. With this enzyme concentrator, the basal buffer of the enzyme solution was changed to 50 mM potassium phosphate buffer, pH 6.5, by diluting the concentrated enzyme solution 100-fold with the new buffer, concentrating it to the original volume, and then repeating the dilution and concentration steps; the second concentrated enzyme solution was subjected to an enzyme assay. The protein concentration was determined by the dye-binding assay (7).
Native molecular weight, N-terminal amino acid sequence, and protein concentration analyses.
The purified enzyme was subjected to gel filtration column chromatography (HiLoad 26/60 Superdex 200 pg; Amersham Pharmacia, Japan) to determine the native molecular weight. The molecular mass was calibrated with the following standard proteins (Amersham Pharmacia, Japan): bovine thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), aldolase (158 kDa), bovine serum albumin (67 kDa), ovalbumin (43 kDa), chymotrypsinogen (25 kDa), and RNase (13.7 kDa).
The purified enzyme was subjected to SDS-PAGE and electroblotted onto polyvinylidene difluoride membranes (Nippon Genetics, Tokyo, Japan). The N-terminal amino acid sequence was determined by the Edman degradation method with the peptide sequencer described previously (18). The UV-Vis absorption spectrum was recorded on a Hitachi U3300 spectrophotometer (Hitachi, Tokyo, Japan) with a quartz cuvette with a 1-cm path length. The molar absorption coefficient of the purified protein was determined by averaging the quantities of alanine, proline, valine, threonine, and tyrosine from the quantitative amino acid analysis performed at the Toray Research Center, Inc. (Kamakura, Japan), with a Hitachi model L-8500 amino acid analyzer (Hitachi, Tokyo, Japan).
The flavin content was determined by high-performance liquid chromatography analysis according to a previously described method with a Capcell Pack C18 column (4.6 by 150 mm; Shiseido Co., Ltd., Tokyo, Japan) with 5 mM ammonium acetate-methanol buffer as the mobile phase (18). Flavin was identified with riboflavin, FAD, and flavin mononucleotide (FMN) as standards. Data represent the means ± standard deviations of three independent measurements.
Enzyme properties.
The pH optimum of the purified enzyme was determined in 50 mM potassium phosphate buffer in a pH range of 5.0 to 8.0 at 37°C, which is the optimum growth temperature for B. bifidum. The temperature optimum of the purified enzyme was determined in 50 mM potassium phosphate buffer, pH 6.5, over a range of 25 to 60°C. Enzyme inhibitors were added to the enzyme solution at a final concentration of 1 mM, and the solutions were incubated for 5 min at 37°C; reactions were started by the addition of an enzyme-inhibitor mixture (18).
H2O2 production by the B. bifidum NADH oxidase reaction was detected while monitoring O2 production with an oxygen electrode by adding catalase to the reaction vessel (18, 21). Catalase catalyzes the stoichiometric conversion of 1 mol H2O2 to 1 mol H2O and 0.5 mol O2. The H2O2-forming-type NADH oxidase produces 50% O2 after the addition of catalase to the total amount of O2 consumed by the NADH oxidase reaction. H2O-forming-type NADH oxidase produces no O2 after the addition of catalase.
The substrate specificity of the purified enzyme was assayed spectrophotometrically at 37°C with 50 mM potassium phosphate buffer, pH 6.5, containing 5 µM EDTA. Electron acceptors for the enzyme were investigated by adding various substrates (final concentration, 50 µM) to the anaerobic cuvette together with the enzyme solution. For all acceptors except O2, the reactions were carried out under anoxic conditions by purging the anaerobic glass cuvette containing the reaction buffer with O2-free argon gas. NADH (final concentration, 150 µM) or DHO (final concentration, 150 µM) was used as an electron donor for the enzyme. For the reactions of NADH:acceptor oxidoreductase and DHO:acceptor oxidoreductase, 1 U of activity was defined as the amount of enzyme that catalyzes the reduction of 1 µmol of NADH (
340 = 6,220 M–1 cm–1) or the production of 1 µmol of orotic acid (
278 = 7,700 M–1 cm–1) per min, respectively. For the assays of DCIP and cytochrome c, 1 U of activity was defined as the amount of enzyme that catalyzes the reduction of 1 µmol of DCIP (
600 = 22,000 M–1 cm–1) or cytochrome c (
550 = 18,500 M–1 cm–1) per min, respectively. The values for enzyme inhibition (percent), relative activities (percent), and the specific activities (U/mg protein) are the average of three independent measurements that varied by less than 5%.
Steady-state kinetics.
Kinetic parameters of the purified enzyme were determined by the following experiment. Initial rates were determined from linear plots of product formation (or substrate disappearance). The NADH oxidase assay, in which the oxidation of NADH is coupled to the reduction of O2, was performed with an oxygen electrode to monitor the decrease in O2 after the addition of NADH and enzyme solution. The DHOD assay, in which the oxidation of DHO is coupled to the reduction of NAD+, was performed with a spectrophotometer to monitor the reduction of NAD+ at 340 nm (
340 = 6,220 M–1 cm–1) or the oxidation of DHO at 278 nm (
278 = 7,700 M–1 cm–1). The NADH:orotate oxidoreductase assay, in which the oxidation of NADH is coupled to the reduction of orotate, was performed with a spectrophotometer to monitor the oxidation of NADH at 340 nm or the reduction of orotate at 278 nm (
278 = 7,700 M–1 cm–1). All reactions were carried out in anaerobic glass cuvettes by O2-free techniques. For the NADH oxidase assay, buffer solutions containing different concentrations of dissolved O2 were prepared by purging with N2-based gas containing different O2 concentrations; the final dissolved O2 concentrations in the reaction cuvette were checked with an O2 electrode prefitted to a cuvette with a rubber seal to prevent oxygen contamination from outside of the cuvette. The apparent Km, Vmax, and kcat values for NADH and O2 (NADH oxidase reaction), DHO and NAD+ (DHO:NAD+ oxidoreductase), and NADH and orotate (NADH:orotate oxidoreductase) were determined by varying the concentrations of both NADH (14.4, 18.5, 25.6, 45.3, and 123 µM) and O2 (expected concentrations of 62.5, 125, 262.5, 625 and 1,087.5 µM; data were plotted based on the actual concentrations at measurements), both DHO (10, 30, 60, and 120 µM) and NAD+ (20, 40, 80, 120, and 200 µM), or both NADH (14.4, 18.5, 25.6, and 45.3 µM) and orotate (10.9, 19.9, 53.6, and 105.5 µM), respectively, in 50 mM potassium phosphate buffer, pH 6.5. The Michaelis-Menten constants were determined by nonlinear regression analysis with Enzyme Kinetics Module 1.3 (Sigma Plot 11; SYSTAT Software, Chicago, IL). The values given are the means ± standard errors of two independent measurements, each performed in duplicate.
Genetic analysis.
The degenerated sense primer for the N-terminal sequence of B. bifidum PyrDb (5'-ATGGAYGCNGTNACNGAYAC, in which Y is C or T and N is A, T, G, or C) and the antisense primer from the conserved region of PyrDb among other Bifidobacterium species (5'-CCNCCNANDCCDATDATNGG, in which N is A, C, G, or T and D is G, A, or T) were used for the first PCR. B. bifidum genome DNA was extracted and used as the template. The PCR fragment obtained (0.8 kb) was cloned into the pT7Blue vector (Novagen, Tokyo, Japan) and sequenced. Sequence analysis indicated that the PCR product obtained encoded the N-terminal part of the target protein. The extended genome region was further amplified with PCR primers obtained from the nucleotide sequence of a 0.8-kb PCR fragment by the method of DNA walking PCR technology according to the manufacturer's manual (DNA Walking Speedup Premix Kit; Seegene, Seoul, South Korea) (14). Extended genome regions (upstream region of pyrDb and downstream region of pyrDb) were amplified by DNA walking PCR technology, and the PCR products were directly sequenced. PCR primers were synthesized from the 5' region of the pyrDb upstream PCR fragment (CGCAGGACATGCGCGACGAC) and from the 3' region of the pyrDb downstream PCR fragment (AGCCCGTCAGCGCCGGATAC). With these primers, a 2.7-kb genome region was amplified with the B. bifidum genome as the template and the PCR product was directly sequenced.
A multiple alignment of 22 currently known DHOD sequences reported by Björnberg et al. (6), together with our newly selected sequences of DHOD from Streptococcus mutans families 1A (NP_721028) and 1B (NP_721602), Clostridium acetobutylicum family 1B (NP_349257), Enterococcus (previously Streptococcus) faecalis family 1B (NP_815420), and Bifidobacterium longum family 1B (NP_695968), was made. A taxonomic analysis was performed with the ClustalW program (46) at DDBJ (http://www.ddbj.nig.ac.jp). Phylogenetic trees were computed with ClustalW by the neighbor-joining method with Kimura's correction (bootstrap scores for 1,000 iterations). Trees were displayed with the TreeView program (36).
Nucleotide sequence accession number.
The 2.7-kb nucleotide sequence data reported here have been deposited in the DDBJ/EMBL/GenBank database under accession number AB374935.
|
|
|---|
![]() View larger version (19K): [in a new window] |
FIG. 1. Chromatographic elution profiles of B. bifidum NADH and NADPH oxidases. Cell extracts, after treatment with streptomycin sulfate and ammonium sulfate, were applied to a Butyl-Toyopearl column equilibrated with 1 M ammonium sulfate dissolved in 50 mM potassium phosphate buffer, pH 7.0. After loading of the sample, bound proteins were eluted with a linear gradient of 800 to 0 mM ammonium sulfate (AS) dissolved in the same buffer. Dashed line, protein absorption at 280 nm; black circles, NADH oxidase activity; white circles, NADPH oxidase activity; solid line, ammonium sulfate concentration (conc.).
|
|
View this table: [in a new window] |
TABLE 1. Purification of NADH oxidase from microaerobically grown B. bifidum
|
![]() View larger version (48K): [in a new window] |
FIG. 2. SDS-PAGE of purified B. bifidum DHOD. After electrophoresis, the gel was stained with Coomassie brilliant blue. The protein standards (lane 1) and purified protein (lane 2) are indicated, along with the corresponding molecular masses (indicated on the left in kilodaltons). Arrows indicate the corresponding subunit name deduced from the N-terminal amino acid sequences.
|
Sequence homology.
The nucleotide sequence of a 2.7-kb genome region was determined and was found to contain three open reading frames named pyrK, pyrDb, and pyrE (Fig. 3). Upstream of pyrK, a possible end codon for pyrF was found (10 of the residues [underlined] in the C-terminal 13-amino-acid [aa] sequence of B. bifidum PyrF [QDMRDDLRVNVYR] were identical to those in the C-terminal 13-aa sequence of B. longum PyrF [LDMRDNLRVAVYR, accession number NP_695970]). The pyrK gene encodes a protein of 276 aa. PyrK from B. bifidum showed 28.7% identity (64.8% similarity) to structurally and functionally well-characterized Lactococcus lactis protein PyrK (accession number NP_267503) (2, 39, 40). The cysteine ligands of the iron-sulfur cluster that is conserved among bacterial PyrK proteins (40) are all conserved in B. bifidum PyrK (Cys241, Cys246, Cys249, and Cys261). The pyrDb gene encodes a protein of 315 aa. PyrDb from B. bifidum also showed 42.1% identity (75.9% similarity) to L. lactis PyrDb (accession number NP_267502) (2, 39, 40). Both the bacterial PyrK and PyrDb proteins are known to act as DHOD via a heterotetramer structure containing two PyrK and two PyrDb subunits (4, 27, 32). The B. bifidum pyrE gene encodes a protein of 232 aa. B. bifidum PyrE showed 43.7% identity (82.2% similarity) to Escherichia coli PyrE (accession number P0A7E3) (37). PyrE catalyzes the orotate phosphoribosyltransferase reaction, which is the fifth step in the pyrimidine biosynthetic pathway (14, 35). In the genome databases of B. longum (accession number NC_004307) and B. adolescentis (accession number NC_008618), the pyrDb and pyrK genes are both located in a 6.5-kb operon structure comprising pyrB-pyrI-pyrC-pyrF-pyrK-pyrDb-pyrE (Fig. 3). The order of the pyrFKDbE genes identified in B. bifidum is the same as that in B. longum and B. adolescentis. The order of the pyrK and pyrDb genes is well conserved in the genomes of bacterial species such as L. lactis (pyrKDbF) (2), E. faecalis (pyrKDbFE) (genome accession no. NC_004668), Bacillus subtilis (pyrKDbFE) (16), and C. acetobutylicum (pyrFKDb) (34). Both the pyrE and pyrF genes are conserved in the bacterial genome, but their order and localization in the genome depend on the species.
![]() View larger version (10K): [in a new window] |
FIG. 3. Comparison of pyr gene clusters from B. bifidum, B. longum, and L. lactis (2). Open arrows indicate the sizes and transcriptional directions of the genes. In B. bifidum, a 2.7-kb genome region was determined. Upstream of pyrK, a possible end codon of pyrF was found. In B. longum, a 6.5-kb genome region was found to encode a pyr gene cluster (pyrB to pyrE) by the genome project. In L. lactis, a 3.2-kb genome region encodes a pyr gene cluster (pyrK to orfC). An orfA gene has been reported to be transcribed independently by the pyrK operon (2).
|
The purified enzyme (brownish yellow) showed a typical flavoprotein spectrum with absorption maxima at 280, 373, and 450 nm (A280/A373 = 4.0, A280/A450 = 4.0) with a shoulder above 500 nm (Fig. 4). The molar extinction coefficient at 450 nm was determined to be
450 = 66.76 M–1 cm–1 (heterotetramer). The flavin content was calculated as 1.78 ± 0.08 mol FAD and 2.06 ± 0.08 mol FMN/mol protein (heterotetramer). The findings about the spectrum features and structural properties of B. bifidum DHOD are commonly conserved in other b-type DHODs of gram-positive bacteria, including Clostridium oroticum (previously classified as "Zymobacterium oroticum") (4, 28), L. lactis (32), E. faecalis (27), and B. subtilis (16).
![]() View larger version (14K): [in a new window] |
FIG. 4. Absorption spectrum of DHOD. The absorption (Abs) spectrum of the purified DHOD enzyme in 50 mM sodium phosphate, pH 7.0, at 25°C was determined. The inset shows the enzyme absorption spectrum before (black line) and after (dashed line) anaerobic reduction with 0.15 mM NADH.
|
When DHO was used as the substrate with NAD+ as the electron acceptor under anaerobic conditions (corresponds to the DHOD reaction), the pH optimum was determined to be 7.5. The following kinetic data were obtained at pH 6.5, which is the pH optimum for the NADH oxidase reaction. This was done for two reasons, first to obtain a set of kinetic data for all activities under the same conditions and to compare the kinetic data to those found in previous reports (28) and second because the pH optimum for the growth of Bifidobacterium species is under acidic conditions below pH 7.0. The activity of the DHOD reaction at pH 6.5 corresponds to 70% of the activity at the optimum pH of 7.5.
The effects of inhibitors and metal ions on the enzyme reactions were investigated (Table 2). The NADH oxidase reaction and the DHOD reaction were both strongly inhibited by HgCl2 and p-chloromercuribenzoate, which are inhibitors of enzymes containing sulfhydryl groups in their catalytic centers (47). Quinine and quinacrine, known inhibitors of flavoproteins (3), did not produce any significant inhibition. Interestingly, cyanide treatment specifically inhibited the DHOD reaction completely but had no effect on the NADH oxidase reaction.
|
View this table: [in a new window] |
TABLE 2. Effects of inhibitors on the NADH oxidase and DHO:NAD+ oxidoreductase activities of B. bifidum DHOD
|
The enzyme catalyzed electron transfers from NADH and DHO to O2, orotate, Q0, cytochrome c, dichloroindophenol (an artificial electron acceptor used for NADH dehydrogenase), and menadione (Table 3). B. bifidum DHOD shows low oxidase activity when DHO is used as an electron donor. Although B. bifidum DHOD efficiently transfers electrons to substrates for the O2 respiratory chain such as quinones and cytochrome c, Bifidobacterium species lack a respiratory chain and do not have the ability to synthesize these compounds (29). These results proposed that the natural electron acceptor of B. bifidum DHOD under anaerobic growth conditions is NAD+, which is also suggested to be a natural electron acceptor for DHOD from other gram-positive bacteria lacking an O2 respiration chain such as L. lactis (32) and C. oroticum (4). Fumarate, which is the preferred electron acceptor for A-type DHOD (1), was not used as a substrate.
|
View this table: [in a new window] |
TABLE 3. Determination of electron acceptors in the NADH oxidase and DHO:NAD+ oxidoreductase reactions of B. bifidum DHOD
|
|
View this table: [in a new window] |
TABLE 4. Kinetic parameters of b-type DHOD
|
|
|
|---|
![]() View larger version (28K): [in a new window] |
FIG. 5. Evolutionary tree for DHOD. An evolutionary tree depicting the relationships among 27 different DHOD sequences is shown. DHOD sequences were classified into three major families, 1A, 1B, and 2 (6).
|
In anaerobes lacking an O2 respiratory chain, H2O-forming-type NADH oxidase has been purified and characterized as the central O2 metabolic enzyme from several bacterial species, including E. faecalis (41), S. mutans (13), Clostridium aminovalericum (18), and Thermotoga hypogea (49). This enzyme is distributed widely in the genome of anaerobes and facultative anaerobes and is proposed to be involved in the detoxification of O2 to H2O. The kinetic parameters for molecular oxygen have been reported for the H2O-forming-type NADH oxidases from C. aminovalericum (18) and T. hypogea (49) as Kms for O2 of 61.9 and 85 µM, respectively. The O2 concentration of the air-saturated medium is approximately 210 µM at the growth temperature, suggesting that the reactivity of the B. bifidum DHOD toward O2 (apparent Km for O2 = 779 ± 82 µM) is significantly lower than that of H2O-forming NADH oxidase. When comparing the specific activities of NADH oxidase reactions among enzymes under air-saturated conditions at 37°C, B. bifidum DHOD (29.1 U/mg protein) is estimated to have one-third to one-fifth of the specific activity of the H2O-forming NADH oxidase (e.g., the specific activity of C. aminovalericum NADH oxidase is 130 U/mg of protein [18] and that of S. mutans NADH oxidase is 100 U/mg of protein [13]). A BLAST search of the public genome databases for B. longum and B. adolescentis identified a homologue of H2O-forming NADH oxidase in B. longum (accession number NP_696431) but not in B. adolescentis. Although it is not clear whether the gene is conserved in B. bifidum, the H2O-forming-type activity was not detected in any fraction during purification. These results suggest that the gene does not exist or that the protein is expressed at levels below the detection limit in B. bifidum.
B. bifidum suffers oxidative growth inhibition over a range of 10 to 21% (air) O2 conditions (approximately 100 µM to 210 µM dissolved O2 in the medium). When the cells are grown under 5% O2 conditions (approximately 50 µM dissolved O2), they grow well without accompanying H2O2 production (21). These results indicated that H2O2 production depends on the concentration of dissolved O2. This O2-dependent growth of B. bifidum is closely correlated with the reactivity of B. bifidum DHOD to O2.
In this study, B. bifidum DHOD was proposed to play a central role in the production of H2O2 under highly aerated conditions. Although a gene disruption technique has not been established for Bifidobacterium species, mutation work will help to clarify the involvement of this enzyme in oxidative growth inhibition.
This work was supported by a grant-in-aid for scientific research from the Japan Society for the Promotion of Science (to S.K.).
Published ahead of print on 5 December 2008. ![]()
Supplemental material for this article may be found at http://aem.asm.org/. ![]()
Both authors contributed equally to this work and are co-first authors. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»