This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tang, H.
Right arrow Articles by Xu, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, H.
Right arrow Articles by Xu, P.
Agricola
Right arrow Articles by Tang, H.
Right arrow Articles by Xu, P.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, February 2009, p. 772-778, Vol. 75, No. 3
0099-2240/09/$08.00+0     doi:10.1128/AEM.02300-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Novel Nicotine Oxidoreductase-Encoding Gene Involved in Nicotine Degradation by Pseudomonas putida Strain S16 {triangledown} ,{dagger}

Hongzhi Tang,1,2 Lijuan Wang,1,{ddagger} Xiangzhou Meng,2,{ddagger} Lanying Ma,2,{ddagger} Shuning Wang,2,{ddagger} Xiaofei He,1 Geng Wu,1 and Ping Xu1,2*

Key Laboratory of Microbial Metabolism, Ministry of Education, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, People's Republic of China,1 State Key Laboratory of Microbial Technology, Shandong University, Jinan 250100, People's Republic of China2

Received 7 October 2008/ Accepted 27 November 2008


arrow
ABSTRACT
 
There are quite a few ongoing biochemical investigations of nicotine degradation in different organisms. In this work, we identified and sequenced a gene (designated nicA) involved in nicotine degradation by Pseudomonas putida strain S16. The gene product, NicA, was heterologously expressed and characterized as a nicotine oxidoreductase catalyzing the initial steps of nicotine metabolism. Biochemical analyses using resting cells and the purified enzyme suggested that nicA encodes an oxidoreductase, which converts nicotine to 3-succinoylpyridine through pseudooxynicotine. Based on enzymatic reactions and direct evidence obtained using H218O labeling, the process may consist of enzyme-catalyzed dehydrogenation, followed by spontaneous hydrolysis and then repetition of the dehydrogenation and hydrolysis steps. Sequence comparisons revealed that the gene showed 40% similarity to genes encoding NADH dehydrogenase subunit I and cytochrome c oxidase subunit I in eukaryotes. Our findings demonstrate that the molecular mechanism for nicotine degradation in strain S16 involves the pyrrolidine pathway and is similar to the mechanism in mammals, in which pseudooxynicotine, the direct precursor of a potent tobacco-specific lung carcinogen, is produced.


arrow
INTRODUCTION
 
Tobacco consumption is one of the leading preventable causes of death and disease in the world. Nicotine, a major toxic component of tobacco, can cross biological membranes and the blood-brain barrier easily (3, 9, 16). During cigarette manufacturing, large quantities of tobacco waste with high concentrations of nicotine are produced, and the disposal of these wastes is a serious ecological problem (4, 14). Many investigators worldwide have developed processes for biodegrading tobacco wastes containing the highly toxic alkaloid nicotine in the environment by mineralization with soil bacteria. Communities of bacteria in soils have adapted to nicotine as a growth substrate and have developed biochemical strategies to degrade this organic heterocyclic compound. These microorganisms play important roles in degradation and detoxification of tobacco wastes (4, 13, 19). Various nicotine-degrading bacteria have been described in studies examining the mechanisms of biodegradation of this N-heterocyclic compound. Nicotine degradation by gram-positive bacteria has been studied genetically in detail; however, the catabolic genes of gram-negative bacteria involved in the pyrrolidine pathway are not fully understood (2, 7).

Previous work by our research group with the microorganism Pseudomonas putida S16 indicated that nicotine was transformed by the pyrrolidine pathway. Strain S16 was reported to be a nicotine-metabolizing microorganism on the basis of its ability to convert nicotine to 2,5-dihydroxypyridine (DHP) and succinic acid through N-methylmyosmine, pesudooxynicotine, and 3-succinoylpyridine (SP) (18, 20, 21) (Fig. 1). Previous reports also described cloning of a gene cluster which encoded enzymes involved in the catabolism of nicotine to DHP in strain S16. Despite the work described above, our understanding of the process is still incomplete. Nucleotide sequence analysis of the nicotine gene cluster of P. putida S16 revealed that there were three open reading frames (ORFs); ORF1 was downstream of ORF2 (encoding 6-hydroxy-3-succinoylpyridine hydroxylase [HSP hydroxylase]), while ORF3 was upstream of ORF2 (18). Here we describe cloning, expression, sequencing, and comparative sequence analysis of the nicA gene encoding nicotine oxidoreductase and demonstrate that it is involved in the metabolism of nicotine to SP.


Figure 1
View larger version (9K):
[in this window]
[in a new window]

 
FIG. 1. Initial steps of the proposed pathway for nicotine degradation by P. putida S16. The compounds in boxes were hypothesized and not detected.


arrow
MATERIALS AND METHODS
 
Bacterial strains, plasmids, and growth conditions.
Growth of P. putida S16, which was isolated from soil used continuously for tobacco (Shandong, People's Republic of China), has been described previously (18, 19). Escherichia coli DH5{alpha} was employed as a host for plasmids, and E. coli BL21(DE3) was used as an expression strain. The E. coli cells were grown in Luria-Bertani (LB) broth or on LB agar plates (15% [wt/vol] agar) with appropriate antibiotics at 37°C.

Chemicals.
L-(–)-Nicotine (purity, ≥99%) was purchased from Fluka Chemie GmbH (Buchs Corp., Switzerland). SP was isolated, purified from broth after nicotine was metabolized by strain S16, and used as a standard in this study (21). All other reagents were the highest purity available commercially.

Preparation of N-methylmyosmine.
Bioconversion was carried out at 30°C in 200 ml of deionized water containing resting cells of strain S16 (optical density at 600 nm [OD600], 15) and 2 g liter–1 nicotine in a 1-liter flask with shaking at 120 rpm. The pH of the mixture was adjusted to 4.5 with 0.5 M HCl. During the reaction, aliquots of the mixture were removed and analyzed by thin-layer chromatography (TLC). Nicotine was degraded quickly during the first hour and was almost completely transformed into N-methylmyosmine. The cells were removed by centrifugation (12,000 x g for 20 min), and then the supernatant was evaporated until the volume was 5 ml. The supernatant containing the intermediate N-methylmyosmine was first used for preparative TLC (pTLC) with chloroform, methanol, ethanol, and 0.5 mol liter–1 NaOH (30:2:15:1.5, vol/vol/vol/vol), and the spots containing N-methylmyosmine were scraped off and dissolved in 1 ml of a chloroform-methanol mixture (1:1, vol/vol). The solution was centrifuged (12,000 x g for 20 min) and filtered before further purification by high-performance liquid chromatography (HPLC) with an Agilent 1100 series instrument (Hewlett-Packard Corp., United States) equipped with a KR100-5 C18 column (250 by 4.6 mm; particle size, 5 µm; Agilent). The compounds were separated using a mixture of deionized water and methanol (75:25) as the mobile phase at a flow rate of 0.5 ml min–1 and were tracked by using a UV detector operated at a wavelength of 210 nm. N-Methylmyosmine was identified by gas chromatography-high-resolution mass spectrometry using a Waters GCT mass spectrometer coupled to an Agilent HP6890 gas chromatograph (see Fig. S1 in the supplemental material).

Identification and cloning of nicotine oxidoreductase (NicA).
Transformant GTPF is a transformant that contains the nicotine gene cluster from the strain S16 genomic library (18). Different DNA fragments, including nic3 (bp 4,689 to 139), W1R1F (bp 4,156 to 596), W1R2F (bp 4,156 to 1,317), ORF1 (bp 4,051 to 2,198), ORF1-1 (bp 1 to 911 of the ORF1 gene fragment), ORF1-2 (bp 302 to 1,870 of the ORF1 gene fragment), ORF1-3 (bp 1,604 to 441 of the ORF1 gene fragment), ORF2 (bp 1,056 to 1,994), and ORF3 (bp 40 to 624), were amplified from the nicotine gene cluster by PCR (Fig. 2). Various plasmids used for genetic disruption and identification were constructed with pMD18-T in both orientations. E. coli DH5{alpha} cells carrying plasmid pUC19 (negative control), pMD18-nic3, pMD18-W1R1F, pMD18-W1R2F, pMD18-ORF1, pMD18-ORF1-1, pMD18-ORF1-2, pMD18-ORF1-3, pMD18-ORF2, or pMD18-ORF3 were incubated for 12 h in 5 ml LB medium containing ampicillin (100 µg ml–1) and nicotine (1 g liter–1) at 37°C. Each culture was transferred to 100 ml of fresh medium containing 0.2 mM isopropyl-β-D-thiogalactopyranoside (IPTG) and ampicillin (100 µg ml–1) and incubated at 37°C for another 12 h. Cells were harvested by centrifugation, washed twice with 20 mM phosphate-buffered saline (PBS) (pH 7.4), and resuspended in the same buffer at an optical density OD600 of 40 as resting cells. A reaction mixture containing 1 g liter–1 nicotine, 100 µg ml–1 ampicillin, and 10 ml of a cell suspension (OD600, 15) was shaken at 120 rpm for 12 h in a 50-ml tube. Aliquots of the cell suspension were removed during the reaction, cells were removed by centrifugation at 12,000 x g for 10 min, and then each supernatant was used for TLC and HPLC as described previously (18).


Figure 2
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 2. Positions and directions of various primers and subclones used in this study, as indicated by arrows. Restriction site abbreviations: B, BamHI; E, EcoRI; P, PstI.

Expression and purification of recombinant nicotine oxidoreductase.
The nicA gene was PCR amplified from genomic DNA of strain S16 with Prime STAR HS DNA polymerase (TaKaRa Co. Ltd., People's Republic of China) (15). Primers were designed so that the forward primer contained an EcoRI site and the reverse primer contained a SalI site. The primer sequences (restriction sites are underlined) were as follows: forward primer, 5'-GGCGAATTCTATGCGCGATGCAGAAC-3' (corresponding to positions 4,077 to 4,061 in the nic gene cluster, as previously reported [18]); and reverse primer, 5'-AATGTCGACTGCTGCTGCCGTGTGA-3' (positions 2,223 to 2,238 in the nic gene cluster, as previously reported [18]). PCR amplification was carried out by using 50-µl reaction mixtures containing 50 pmol of each primer, 4 µl of a deoxynucleoside triphosphate mixture, 100 ng of template DNA, and 10 µl of 5x Prime Star buffer. The PCRs were performed by using the following program: 5 min at 94°C and then 29 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C. The PCR products were purified, treated with EcoRI and SalI, and ligated into pET-27b(+) (Novagen Corp., Germany) which had been digested with the same restriction enzymes. The resulting plasmid, designated pET27b-nicA, was used to transform E. coli BL21(DE3). Cells containing the recombinant plasmids were cultured at 37°C in LB medium containing 100 mg liter–1 kanamycin until the OD600 was 0.6. Then IPTG was added to a final concentration of 1 mM, and the culture was incubated for up to 6 h at 30°C to express NicA. The induced E. coli cells were washed and resuspended in binding buffer (20 mM PBS containing 100 mM NaCl and 10 mM imidazole; pH 7.4) at an OD600 of 30. Sonication was performed using 99 cycles consisting of 200 W for 6 s with 6-s intervals between cycles in an ice bath. Cell debris and unbroken cells were removed by centrifugation at 14,000 x g for 20 min. The supernatant was filtered through a 0.22-µm-pore-size filter and loaded onto a 5-ml Ni-nitrilotriacetic acid agarose column (Qiagen Ltd., Crawley, United Kingdom) equilibrated with binding buffer, which was connected to an AKTA Prime Plus purification system (Amersham, Sweden). After the column was washed with 5 column volumes of washing buffer (20 mM PBS containing 100 mM NaCl and 20 mM imidazole; pH 7.4), His6-tagged NicA was eluted from the column with elution buffer (20 mM PBS containing 100 mM NaCl and 100 mM imidazole; pH 7.4). The purified samples (containing 0.5 µg protein) were used to transform 1 g liter–1 nicotine supplemented with 1 mM flavin mononucleotide (FMN). After 1 h of incubation at 30°C in 20 mM PBS (pH 7.4), the reaction mixture was concentrated and developed on pTLC plates (0.50-mm Silica Gel HSGF254) with a solution containing chloroform, methanol, ethanol, and 0.5 M NaOH (30:2:15:1.5, vol/vol/vol/vol). The main spots were scraped off and dissolved with chloroform-methanol (1:1, vol/vol). The eluate was analyzed by using HPLC and electrospray ionization quadrupole time of flight mass spectrometry (ESI-Q-TOF-MS) (Micromass-Waters, Ltd., Manchester, United Kingdom).

RT-PCR.
Total RNA was isolated from transformant GTPF grown in the presence or absence of nicotine using a Total RNA kit I (Omega, United States). Contaminating DNA was treated with DNase I (RNase-free; Fermentas, European Union) at a concentration of 1 U/µg of total RNA for 30 min at 37°C. Reverse transcriptase PCR (RT-PCR) was performed by using 50-µl reaction mixtures containing about 400 ng of total RNA and 20 pmol of each primer with a Prime Script one-step RT-PCR kit (Takara, Japan). The thermocycler program used for RT-PCR was as follows: 50°C for 30 min, 94°C for 2 min, and 30 cycles of 94°C for 30 s, 63.5°C for 30 s, and 72°C for 2 min. Primers were used as described above. RNA was used as a negative PCR control in order to confirm that there was no contaminating in the RNA preparations.


arrow
RESULTS AND DISCUSSION
 
Cloning of a catabolic gene encoding nicotine oxidoreductase.
Nine subclones containing ORF1, ORF2, and ORF3 were constructed to screen for the ability to degrade nicotine. Cells containing the pMD18-nic3 or pMD18-W1R1F plasmid with ORF3 partially or fully deleted could degrade nicotine. The subclones harboring plasmids pMD18-W1R2F and pMD18-ORF1, in which ORF2 was partially or fully deleted, could also degrade nicotine. In addition, no cells with ORF1 deletions (with plasmid pMD18-ORF2 or pMD18-ORF3) were able to degrade nicotine (data not shown). These observations show that ORF1 contains a gene necessary for nicotine degradation, presumably in the first several steps. Resting cells of the transformants containing ORF1 could degrade nicotine to SP (Fig. 3). However, they could not use nicotine as a sole carbon and nitrogen source for cell growth. All the observations described above indicate that ORF1 (nicA) may encode the first key nicotine degradation enzyme and does not contain the genes encoding enzymes involved in later steps. Three other transformants, transformants containing plasmids pMD18-ORF1-1, pMD18-ORF1-2, and pMD18-ORF1-3, were constructed to detect nicotine degradation by resting cells, but no degradation activity was observed (data not shown). These results demonstrate that ORF1 contains the gene for necessary for the initial steps. Moreover, RT-PCR performed with RNA extracted from transformant GTPF and wild-type strain S16 showed that the transcripts of the nicA gene (encoding the enzyme for conversion of nicotine to SP) and the hsp gene (encoding the enzyme for conversion of HSP to DHP) (18) were located in an operon (Fig. 4A).


Figure 3
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 3. (A) HPLC spectrum for the conversion of nicotine to SP by transformant pMD18-ORF1. The spectrum was obtained by using a mixture of 1 mM H2SO4 and methanol (95:5) as the mobile phase at a flow rate of 0.5 ml min–1 and a UV detector operated at a wavelength of 210 nm. P, N-methylmyosmine. (B) TLC analysis of the products formed by incubation of nicotine and whole cells of transformant pMD18-ORF1 at pH 7.0 from 0 to 4 h. Lane M, marker containing 1 g liter–1 nicotine, SP, and HSP as standards.


Figure 4
View larger version (99K):
[in this window]
[in a new window]

 
FIG. 4. (A) Transcriptional analysis by RT-PCR of nicA and hsp genes. Lanes M, marker III (Tiangen, People's Republic of China); lanes 1 and 2, nicA gene with RNA and cDNA of nicotine-induced strain S16, respectively; lanes 3 and 4, nicA gene with RNA and cDNA of transformant GTPF, respectively; lanes 5 and 6, hsp gene with RNA and cDNA of transformant GTPF, respectively; lanes 7 and 8, hsp gene with RNA and cDNA of nicotine-induced strain S16, respectively (the PCR products of nicA and hsp are indicated by arrows). (B) TLC analysis of the effects of various metal ions on purified NicA activity. Lanes 1 to 4, NicA with 1 mM nicotine, 1 mM FMN, and 1 mM Ca2+, Mg2+, Mn2+, and Co2+, respectively; lane 5, NicA with 1 mM nicotine and 1 mM FMN; lane 6, NicA with 1 mM nicotine; lane 7, NicA with 1 mM nicotine, 1 mM FMN, and 1 mM Cu2+; lane 8, NicA with 1 mM nicotine, 1 mM FMN, and 1 mM Ag+; lane 9, NicA with 1 mM FMN and 1 mM Hg2+. P, N-methylmyosmine. (C) SDS-PAGE analysis of overexpressed NicA in E. coli BL21(DE3) on a 12.5% gel. Lane M, protein molecular weight marker (MBI); lane 1, cell extract of E. coli(pET-27b(+); lanes 2 to 5, cell extracts of E. coli(pET27b-ORF1) obtained 4, 6, 8, and 10 h after IPTG induction (indicated by the arrow), respectively. (D) SDS-PAGE analysis of purified His6-tagged NicA, including Coomassie blue staining for purified 65-kDa His6-tagged fusion protein (lanes 1 and 2). (E) SDS-PAGE gel stained with the Invision His tag in-gel stain and imaged with a UV transilluminator equipped with a video camera (lanes 1 and 2 contained purified 65-kDa His6-tagged fusion protein). The molecular masses of markers (in kilodaltons) are indicated on the left. The molecular mass of the overexpressed and purified protein is about 65 kDa.

Expression and purification of recombinant NicA protein.
To obtain purified protein for enzymatic analysis and to verify the prediction for the novel gene, the nicA gene from strain S16 was cloned and expressed in E. coli BL21(DE3) cells to obtain a C-terminal His-tagged fusion protein. After IPTG induction, large amounts of proteins with molecular masses of approximately 65 kDa were found in the E. coli lysate, whereas no such band was observed for uninduced cells or for cells containing the vector alone (Fig. 4C). The cell extracts could transform nicotine to SP, confirming that the nicA gene product has the expected functions. His6-tagged NicA was purified with a Ni-nitrilotriacetic acid affinity column under nondenaturing conditions. The purity of the enzyme was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and a single band was observed on the gel at a molecule mass of 66.2 kDa (Fig. 4D). The hypothesis that the 66-kDa purified protein was His6-tagged NicA was confirmed by staining with the InVision His tag in-gel stain (Fig. 4E). Purified NicA was analyzed further by matrix-assisted laser desorption ionization-time of flight mass spectrometry using peptide mass fingerprinting techniques for an array of peptide masses resulting from enzymatic digestion of the protein isolated from an SDS-PAGE gel (8). The two digested peptides were both identical to the translation products of nicA gene fragments (for DAEKSFTR the MASCOT ion score was 41.4191; for LLSMSPYLTR, the Mascot ion score was 43.3286) (see Fig. S2 in the supplemental material). The MASCOT tool was utilized to identify other known proteins with similar peptide fingerprints, but no match with a significant score was obtained.

Activity of recombinant NicA protein.
Purified NicA was stored in PBS and used to convert nicotine. After 1 h of incubation at 30°C in 20 mM PBS (pH 7.4) containing 1 g liter–1 nicotine and 1 mM FMN, nicotine was converted to three intermediates, while production of the intermediates was not detected if FMN was not added to the mixture (Fig. 4B). All of the intermediates were obtained by pTLC, identified by ESI-Q-TOF-MS, and compared with previously reported data. ESI-Q-TOF-MS analysis showed that the molecular ion peaks [(M+H)+] of N-methylmyosmine (C10H13N2), pseudooxynicotine (C10H15N2O), and SP (C9H10NO3) were at m/z 161.10732, 179.11789, and 180.06552, respectively (see Fig. S3 to S5 in the supplemental material). Both the molecular weights and the chemical formulas of these intermediates also matched previously described data (21). Based on these results, the single enzyme NicA might be responsible for the initial consecutive steps of the nicotine metabolic pathway in strain S16. Similar kinds of mechanisms were reported previously for L-6-hydroxynicotine oxidase or D-6-hydroxynicotine oxidase in the nicotine degradation pathway of Arthrobacter (1, 5) and for a monooxygenase catalyzing sequential dechlorinations of 2,4,6-trichlorophenol in oxidative and hydrolytic reactions (22). Based on known reaction mechanisms for flavoproteins along with general chemical considerations, we hypothesized that the pyrrolidine ring of nicotine was oxidized by NicA to form N-methylmyosmine. The spontaneous ring opening of N-methylmyosmine due to the addition of water generated pseudooxynicotine, which was further oxidized to SP by NicA through two hypothesized unstable compounds and the removal of methylamine (Fig. 1). The transformation of pseudooxynicotine to SP was similar to 2-phenylethylamine catabolism (6). In order to further verify the proposed mechanism, N-methylmyosmine was isolated from resting cell reaction mixtures of strain S16 by pTLC and HPLC. When N-methylmyosmine was stored in water, pseudooxynicotine was spontaneously produced. 18O labeling experiments provided direct evidence that there was incorporation of oxygen from H218O in the pseudooxynicotine produced (Fig. 5). While N-methylmyosmine was added to the enzyme reaction mixtures, SP was produced, which was detected by ESI-Q-TOF-MS. Labeled [18O]SP was not found during the detection procedure. The low concentration of labeled [18O]pseudooxynicotine in the enzymatic reaction system and the low mass spectrum response of this compound might be explanations for the observations. Brandsch et al. reported that the pyrrolidine ring of 6-hydroxy-L-nicotine could be oxidized by 6-hydroxy-L-nicotine oxidase from Arthrobacter nicotinovorans pAO1, a dimeric enzyme, with one flavin adenine dinucleotide molecule per subunit. The 6-hydroxy-methylmyosmine formed in this reaction was spontaneously converted into 6-hydroxy-pseudooxynicotine by addition of water to the double bond (2). In our study, the decrease in the amount of nicotine and the generation of the intermediate by the purified enzyme were not observed if FMN was not added to the reaction mixture. The results of the NicA reaction proved that FMN is necessary and plays an important role in nicotine degradation, as well as in the function of flavin adenine dinucleotide in 6-hydroxy-L-nicotine oxidase. The effects of various metal ions on the enzyme activity were investigated by TLC analysis. The enzymatic activity was strongly inhibited by Cu2+, Hg2+, and Ag+, and the enzyme was slightly activated by Ca2+ and Co2+. Mg2+, and Mn2+ had no obvious effects on the enzyme (Fig. 4B). In addition, electron acceptors, such as 2,6-dichloroindophenol and potassium ferrocyanide, were added to the enzymatic reaction mixture but did not contribute to the activity of NicA (data not shown).


Figure 5
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 5. Mass spectra of N-methylmyosmine and pseudooxynicotine as determined by ESI-Q-TOF-MS analysis. The mass spectra of derivatized pseudooxynicotine were obtained from reactions without H218O (A) and with 45% H218O (B). The positions of the peaks for N-methylmyosmine, [16O]pseudooxynicotine, and [18O]pseudooxynicotine are indicated by arrows.

Nucleotide and protein sequence analysis.
The DNA-derived amino acid sequence of the nicA gene product was compared to known protein sequences in the NCBI data library deposited under accession number DQ988162. Sequence comparisons revealed that the gene product showed 40% similarity to NADH dehydrogenase subunit I and cytochrome c oxidase subunit I from eukaryotes (Fig. 6). However, no similarities to sequences of bacterial dehydrogenase or oxidase were found. A Shine-Dalgarno sequence (17) was found in the region upstream of the putative initiation codon of ORF1 (CTTAAGGAGAGTGTAGGTATGCGCGAT). Moreover, the reverse transcriptase catalytic domain analysis revealed three possible magnesium binding sites in the nicA sequence (12). In addition, this ORF had no significant homology with other genes for degradation of heterocyclic compounds. Therefore, the nicA nucleotide sequence seems to be unique among the nucleotide sequences of bacterial nicotine catabolic genes and more closely related to sequences of higher organisms. Furthermore, at both ends of the gene cluster, putative transcriptional regulators of P. putida were identified by the NCBI BLAST program, which suggested that this cluster had some characteristics similar to those of Pseudomonas genes.


Figure 6
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 6. Schematic diagram of NCBI BLAST results for the nicA gene analysis. The fractions of residues whose alignment scores are high positive values (>40%) are indicated by boxes that are different colors.

The mechanism used for nicotine degradation in strain S16 is very similar to a branch pathway of mammalian nicotine metabolism initiated by 2'-hydroxylation, followed by pseudooxynicotine and SP (10, 11). Since the molecular and enzymatic mechanisms of mammalian 2'-hydroxylation are not clear, the enzyme from bacteria may be useful for identifying new enzymes involved in nicotine degradation in mammals. In addition to providing information about nicotine degradation by microorganisms, the discovery of the mechanistic similarity between microorganisms and complicated mammals may indicate that there is a connection between higher and lower organisms.

In summary, the novel nicA gene obtained from strain S16 encoded a nicotine oxidoreductase for nicotine degradation. Our studies clearly showed the pyrrolidine pathway involved in nicotine degradation by a gram-negative Pseudomonas strain, although the pyridine pathway was proposed more than 50 years ago (7). This work provided basic knowledge that can be used for analysis of nicotine degradation in bacteria, and further research should include functional and mechanistic studies of the NicA protein.


arrow
ACKNOWLEDGMENTS
 
We thank three anonymous reviewers for helpful comments on drafts of the manuscript. We acknowledge Kun He and Hong Xia Wang (National Center of Biomedical Analysis, People's Republic of China) for analyzing the ESI-Q-TOF-MS results and Dake Zhang (Beijing Institute of Genomics, Chinese Academy of Sciences) for performing the nucleotide sequence analysis.

This work was supported in part by grants from the Chinese National Natural Science Foundation (grants 30821005 and 20607012) and from the Ministry of Science and Technology of China (National Basic Research Program of China grant 2009CB118906).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, People's Republic of China. Phone: 86-21-34206647. Fax: 86-21-34206723. E-mail: pingxu{at}sjtu.edu.cn Back

{triangledown} Published ahead of print on 5 December 2008. Back

{dagger} Supplemental material for this article may be found at http://aem.asm.org/. Back

{ddagger} L.W., X.M., L.M., and S.W. contributed equally to this work. Back


arrow
REFERENCES
 
    1
  1. Brandsch, R., W. Faller, and K. Schneider. 1986. Plasmid pAO1 of Arthrobacter oxidans encodes 6-hydroxy-D-nicotine oxidase: cloning and expression of the gene in Escherichia coli. Mol. Gen. Genet. 202:96-101.[CrossRef][Medline]
  2. 2
  3. Brandsch, R. 2006. Microbiology and biochemistry of nicotine degradation. Appl. Microbiol. Biotechnol. 69:493-498.[Medline]
  4. 3
  5. Campain, J. A. 2004. Nicotine: potentially a multifunctional carcinogen? Toxicol. Sci. 79:1-3.[Free Full Text]
  6. 4
  7. Civilini, M., C. Domenis, N. Sebastianutto, and M. Bertoldi. 1997. Nicotine decontamination of tobacco agro-industrial waste and its degradation by micro-organisms. Waste Manage. Res. 15:349-358.[Abstract/Free Full Text]
  8. 5
  9. Decker, K., and V. D. Dai. 1967. Mechanism and specificity of L- and D-6-hydroxynicotine oxidase. Eur. J. Biochem. 3:132-138.[Medline]
  10. 6
  11. Diaz, E., A. Ferrandez, M. A. Prieto, and J. L. Garcia. 2001. Biodegradation of aromatic compounds by Escherichia coli. Microbiol. Mol. Biol. Rev. 65:523-569.[Abstract/Free Full Text]
  12. 7
  13. Eberhardt, H. J. 1995. The biological degradation of nicotine by nicotinophilic microorganisms. Beitr. Tabakforsch. Int. 16:119-129.
  14. 8
  15. Falkner, J. A., M. Kachman, D. M. Veine, A. Walker, J. R. Strahler, and P. C. Andrews. 2007. Validated MALDI-TOF/TOF mass spectra for protein standards. J. Am. Soc. Mass Spectrom. 18:850-855.[CrossRef][Medline]
  16. 9
  17. Gorrod, J. W., and P. Jacob III. 2002. Analytical determination of nicotine, and related compounds, and their metabolites. Elsevier Press, Amsterdam, The Netherlands.
  18. 10
  19. Hecht, S. S. 1999. Tobacco smoke carcinogens and lung cancer. J. Natl. Cancer Inst. 91:1194-1210.[Abstract/Free Full Text]
  20. 11
  21. Hecht, S. S., J. B. Hochalter, P. W. Villalta., and S. E. Murphy. 2000. 2'-Hydroxylation of nicotine by cytochrome P450 2A6 and human liver microsomes: formation of a lung carcinogen precursor. Proc. Natl. Acad. Sci. USA 97:12493-12497.[Abstract/Free Full Text]
  22. 12
  23. Hulo, N., A. Bairoch, V. Bulliard, L. Cerutti, E. D. Castro, P. S. Langendijk-Genevaux, M. Pagni, and C. J. A. Sigrist. 2006. The Prosite database. Nucleic Acids Res. 34:D227-D230.[Abstract/Free Full Text]
  24. 13
  25. Kaiser, J. P., Y. Feng, and J. M. Bollag. 1996. Microbial metabolism of pyridine, quinoline, acridine, and their derivatives under aerobic and anaerobic conditions. Microbiol. Mol. Biol. Rev. 60:483-498.[Abstract/Free Full Text]
  26. 14
  27. Novotny, T. E., and F. Zhao. 1999. Consumption and production waste: another externality of tobacco use. Tob. Control 8:75-80.[Abstract/Free Full Text]
  28. 15
  29. Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
  30. 16
  31. Schievelbein, H. 1982. Nicotine, resorption and fate. Pharmacol. Ther. 18:233-248.[CrossRef][Medline]
  32. 17
  33. Shine, J., and L. Dalgarno. 1975. Determinant of cistron specificity in bacterial ribosomes. Nature 254:34-38.[CrossRef][Medline]
  34. 18
  35. Tang, H. Z., S. N. Wang, L. Y. Ma, X. Z. Meng, Z. X. Deng, D. K. Zhang, C. Q. Ma, and P. Xu. 2008. A novel gene encoding 6-hydroxy-3-succinoylpyridine hydroxylase in nicotine degradation by Pseudomonas putida strain S16. Appl. Environ. Microbiol. 74:1567-1574.[Abstract/Free Full Text]
  36. 19
  37. Wang, S. N., P. Xu, H. Z. Tang, J. Meng, X. L. Liu, J. Huang, H. Chen, Y. Du, and H. D. Blankespoor. 2004. Biodegradation and detoxification of nicotine in tobacco solid waste by a Pseudomonas sp. Biotechnol. Lett. 26:1493-1496.[CrossRef][Medline]
  38. 20
  39. Wang, S. N., P. Xu, H. Z. Tang, J. Meng, X. L. Liu, and C. Q. Ma. 2005. ‘Green’ route to 6-hydroxy-3-succinoyl-pyridine from (S)-nicotine of tobacco waste by whole cells of a Pseudomonas sp. Environ. Sci. Technol. 39:6877-6880.[Medline]
  40. 21
  41. Wang, S. N., Z. Liu, H. Z. Tang, J. Meng, and P. Xu. 2007. Characterization of environmentally friendly nicotine degradation by Pseudomonas putida biotype A strain S16. Microbiology 153:1556-1565.[Abstract/Free Full Text]
  42. 22
  43. Xun, L. Y., and C. M. Webster. 2004. A monooxygenase catalyzes sequential dechlorinations of 2,4,6-trichlorophenol by oxidative and hydrolytic reactions. J. Biol. Chem. 279:6696-6700.[Abstract/Free Full Text]


Applied and Environmental Microbiology, February 2009, p. 772-778, Vol. 75, No. 3
0099-2240/09/$08.00+0     doi:10.1128/AEM.02300-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tang, H.
Right arrow Articles by Xu, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tang, H.
Right arrow Articles by Xu, P.
Agricola
Right arrow Articles by Tang, H.
Right arrow Articles by Xu, P.