Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Heneghan, M. N. Articles by Foster, G. D. Search for Related Content PubMed PubMed Citation Articles by Heneghan, M. N. Articles by Foster, G. D. Agricola Articles by Heneghan, M. N. Articles by Foster, G. D.

 Previous Article  |  Next Article 

Applied and Environmental Microbiology, February 2009, p. 792-801, Vol. 75, No. 3
0099-2240/09/$08.00+0     doi:10.1128/AEM.01897-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Characterization of Serine Proteinase Expression in Agaricus bisporus and Coprinopsis cinerea by Using Green Fluorescent Protein and the A. bisporus SPR1 Promoter

Mary N. Heneghan,¹ Claudine Porta,² Cunjin Zhang,² Kerry S. Burton,² Michael P. Challen,² Andy M. Bailey,¹ and Gary D. Foster^1*

School of Biological Sciences, University of Bristol, Bristol BS8 1UG, United Kingdom,¹ Warwick HRI, University of Warwick, Wellesbourne, Warwick CV35 9EF, United Kingdom²

Received 15 August 2008/ Accepted 22 November 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The Agaricus bisporus serine proteinase 1 (SPR1) appears to be significant in both mycelial nutrition and senescence of the fruiting body. We report on the construction of an SPR promoter::green fluorescent protein (GFP) fusion cassette, pGreen_hph1_SPR_GFP, for the investigation of temporal and developmental expression of SPR1 in homobasidiomycetes and to determine how expression is linked to physiological and environmental stimuli. Monitoring of A. bisporus pGreen_hph1_SPR_GFP transformants on media rich in ammonia or containing different nitrogen sources demonstrated that SPR1 is produced in response to available nitrogen. In A. bisporus fruiting bodies, GFP activity was localized to the stipe of postharvest senescing sporophores. pGreen_hph1_SPR_GFP was also transformed into the model basidiomycete Coprinopsis cinerea. Endogenous C. cinerea proteinase activity was profiled during liquid culture and fruiting body development. Maximum activity was observed in the mature cap, while activity dropped during autolysis. Analysis of the C. cinerea genome revealed seven genes showing significant homology to the A. bisporus SPR1 and SPR2 genes. These genes contain the aspartic acid, histidine, and serine residues common to serine proteinases. Analysis of the promoter regions revealed at least one CreA and several AreA regulatory motifs in all sequences. Fruiting was induced in C. cinerea dikaryons, and fluorescence was determined in different developmental stages. GFP expression was observed throughout the life cycle, demonstrating that serine proteinase can be active in all stages of C. cinerea fruiting body development. Serine proteinase expression (GFP fluorescence) was most concentrated during development of young tissue, which may be indicative of high protein turnover during cell differentiation.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Agaricus bisporus, the cultivated mushroom, has economic and biotechnological significance. It is the most extensively cultivated mushroom worldwide, with an annual production in the region of 5 million tonnes (33) and is a major protected crop in the United Kingdom, accounting for 10% of such horticultural production (20). In addition to its value as a food crop, there is considerable interest in A. bisporus as a host for molecular pharming of heterologous proteins (21, 51, 58, 62), and it also appears to produce a number of compounds of potential biomedical and/or nutraceutical importance (13). Application of biotechnology to A. bisporus has greatly increased due to the development of a transformation system (14, 26) and recently Burns et al. (7) developed an A. bisporus "molecular toolkit" which tested different promoters for efficient gene expression. Despite these recent advances, developmental studies in Agaricus have been hampered due to the time and containment issues that exist when studying a genetically modified strain.

The ink-cap mushroom, Coprinopsis cinerea (formerly Coprinus cinereus), is a well-studied homobasidiomycete (12, 43, 47) that forms an excellent model system for studies of gene expression at several levels of differentiation, particularly mushroom development and meiotic processes (46, 59). It has been used as an object for studies of development (32), mainly because of its relatively short life cycle, which can be completed in the laboratory within 2 weeks (44). In addition, genetic studies and experimental manipulation of all phases of its life cycle are simple and relatively straightforward (63). The C. cinerea genome sequence was released in 2003 (http://www.broad.mit.edu) and recently gene silencing has been demonstrated in the basidiomycete (24, 47). We have exploited these characteristics of C. cinerea for the investigation of a serine proteinase from Agaricus bisporus.

A serine proteinase (SPR1) has been purified from a senescent sporophore tissue of A. bisporus, which has a molecular mass of 27 kDa and an isoelectric point of 9.0 (11). The protease has a broad pH optimum, 6.5 to 11.5, and a narrow substrate specificity, requiring both a hydrophobic amino acid in the P1 position and a minimum peptide chain length (11). The most active proteolysis of A. bisporus culture filtrate was observed with Suc-Ala-Ala-Pro-Phe-pNA at neutral pH (10). Serine proteinase was found to be the major proteinase produced by A. bisporus in sporophores during senescence (9), and extracellular to mycelium in colonized compost, where nitrogen is largely in the form of protein, suggesting a nutritional role for this enzyme (10). The serine proteinase extracellular to mycelium was produced to a greater degree in response to protein associated with humic substances than other pure proteins, suggesting factors additional to the protein are involved in its induction. The cDNA for this proteinase has been cloned and sequenced (accession no. Y13805), which revealed that this serine proteinase (SPR) belongs to the "proteinase K family" (31). SPR1 gene expression was not detected in freshly harvested mushrooms, while increased transcript levels were observed 1 to 3 days after harvest. Expression of SPR1 was strongest in postharvest stipe tissue (31), a finding which correlated well with the increase in enzyme activity and protein level detected in senescent stipe (9). The relatively high transcriptional and translational levels of SPR in the stipe demonstrate that the enzyme is important during the metabolism of senescing mushrooms.

We describe here the construction of a promoter::green fluorescent protein (GFP) fusion cassette for the investigation of the temporal and developmental expression of SPR1 in A. bisporus and C. cinerea and to characterize expression in response to physiological and environmental stimuli. We also investigated the utility of C. cinerea as a model system for basidiomycete gene expression and fruiting body production, since the development of a model species for basidiomycetes research is vital for future progress.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Strains and culture maintenance.
Escherichia coli strain DH5 was the host strain for recombinant plasmids. Agrobacterium tumefaciens AGL1 (34) was used for A. bisporus transformations and was cultured as previously described (17, 26). The A. bisporus commercial strain A15 (18) was used for transformations. Mycelia were routinely maintained at 25°C on malt-peptone (35) agar plates and supplemented with 25 µg of hygromycin B ml^–1 to select for transformants. A tryptophan auxotroph, LT2 (A6B6 trp1.1;1.6) (4), was used for C. cinerea transformations. C. cinerea strains AT8 (A43B43 trp-3 ade-8) and AmutBmut (A43mutB43mut pab1) (41, 56) were used for fruiting studies. C. cinerea mycelia were routinely maintained at 37°C on YMG agar (4) supplemented when appropriate with 100 µg of L-tryptophan ml^–1.

Construct design.
An 877-bp A. bisporus SPR putative promoter region (5' untranslated region) was amplified from a cosmid clone template using primers spr1-fwd (TCCCCGCGGCGGGCTCAGAAGGTTTCTAT) and spr1(rev)m (AAATCCATGGTCGGTGAAGAGATC) that, respectively, introduced 5' SacII and 3' NcoI restriction sites. The resulting amplicon was cloned by using pGEM-T Easy (Promega Corp.), and SPR1 promoter integrity was confirmed by double-stranded DNA sequencing of recombinants. The SPR1 promoter was cloned into a pBluescript II-based GFP expression construct (pBlue-SPR-GFP) after removal of the A. bisporus GPDII promoter (SacII-NcoI restriction) from the intron-GFP expression vector p004iGM (6). The 1,884-bp SPR::GFP expression unit was excised by SacI-KpnI restriction and ligated into the ClaI-KpnI restricted binary pGreen_hph1 (18) by the addition of a ClaI-SacI oligolinker (CGAGCT) to yield pGreen_hph1_SPR_GFP.

Fungal transformations.
Plasmid DNA for fungal transformation was prepared by using Qiagen Midi Prep kits. C. cinerea protoplast cotransformations were performed as previously described (4, 6, 22, 24) using ca. 1 µg of pCc1001 (trp1) (54) with 5 µg of plasmid pGreen_hph1_SPR_GFP. Trp⁺ transformants were maintained on Coprinus regeneration agar (RA) (6, 16, 24). Putative transformants of C. cinerea were cultured as described above, and genomic DNA was extracted as previously described (36). PCR screening of C. cinerea transformants was performed using Reddymix components (Abgene) with a general thermal cycling program of 95°C for 3 min; followed by 30 cycles of 95°C for 30 s, 50°C for 1 min, and 72°C for 30 s; followed in turn by 72°C for 10 min.

A. bisporus was transformed by using A. tumefaciens-mediated transfection of gill tissue as previously described (6, 7, 14, 35, 42). Transformants of A. bisporus were identified by using previously published methods (18, 35), and transcription of both hph and GFP transgenes was confirmed by using reverse transcription-PCR and/or quantitative reverse transcription-PCR (24). A. bisporus transformants for fruiting were selected from a large sample set by fluorometric quantification of GFP activity in mycelia (24) after induction with the humic fraction (10).

Fruiting studies.
Dikaryons of C. cinerea were produced on YMGT plates by placing mycelial blocks of AT8 and LT2 Trp⁺ transformants placed 5 mm apart at 37°C; dikaryotization was confirmed by the presence of clamp cells. For growth and induction of fruiting bodies, dikaryons on YMGT plates were incubated under 12 h of light and 12 h of dark at 25°C and with 90% humidity under standard fruiting conditions (22, 37). The C. cinerea strain AmutBmut was selected as a control strain for fruiting studies since it exhibits clamp formation and fruit body development like a dikaryon and produces uninucleate oidia like a monokaryon (56). GFP expression in fruiting bodies was examined by using a Leica MZFL111 microscope with SPOT 2.2.1 (Diagnostic Instruments, Inc.) imaging software.

A. bisporus sporophores were produced in small-scale compost cultures at the University of Warwick's transgenic mushroom containment facility, harvested, and stored as previously described (18). The GFP activity was measured in detached mushrooms at 3 day postharvest by using a portable GFP meter (excitation, 450 nm; emission, 530 nm; gain setting, 55 [ADC BioScientific, Ltd., United Kingdom]). Metered readings were recorded for both cap and stipe tissues of whole mushrooms and the freshly cut face of longitudinally bisected sporophores. A minimum of three replicate readings was taken for each sample tissue from two replicate sporophores. Sectioned mushrooms were also viewed by using a blue LED floodlight (Inova X5; Emissive Energy, North Kingstown, RI) with appropriate blue/yellow filter sets (57) and photographed by using a Nikon Coolpix 990.

Proteinase assays.
A proteinase plate assay was carried out by inoculating C. cinerea LT2 onto ammonium-free RA plates containing 0.5% (wt/vol) skimmed milk powder. To assess proteinase activity, the colony size was measured, as well as the clearing zone around each colony, produced by degradation of the milk layer by extracellular proteinase activity. LT2 was inoculated onto standard RA media as a control. Five replicate plates were measured per assay.

Expression of serine proteinase activity in liquid culture was determined by inoculating LT2 into ammonium-free RA containing 0.5% (wt/vol) milk solution and into standard RA. Cultures were grown for 264 h, and samples (8 ml) were aseptically removed every 24 h and assayed. Serine proteinase activity was measured in fruiting body developmental stages by homogenizing fungal tissue in 50 mM Tris buffer (pH 8.0) and centrifugation at 10,000 x g to remove particulate material.

Serine proteinase activity was assayed spectrophometrically by determining the absorbance at 405 nm after the release of p-nitroaniline from the synthetic peptide Suc-Ala-Ala-Pro-Phe-pNA (0.15 mM) in 50 mM Tris buffer (pH 8.0). Hydrolysis was performed for 30 min at 37°C. Inhibition of serine proteinase was performed by preincubation of 0.1 M phenylmethylsulfonyl fluoride (PMSF; Fluka) inhibitor with the enzyme at 37°C for 30 min. Soluble protein concentrations were measured by the dye-binding method of Bradford (5). Bovine serum albumin was used as a standard. Biochemical assays were performed in triplicate.

Sequence analysis.
Sequences were analyzed by using BLAST (NCBI) (1) and aligned by using CLUSTAL W (25). The sequence manipulation suite (55) performed molecular mass and isoelectric point predictions. Prosite was used to identify motifs and signature sequences in the deduced protein sequences (3), and signal sequences were identified by using SignalP (48). The structural classification of sequences was based on SCOP (45). Transcription factor binding sites were predicted by using MOTIF search on GenomeNet (http://motif.genome.jp/).

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Analysis of A. bisporus pGreen_hph1_SPR_GFP transformants.
To investigate the temporal and spatial expression of the A. bisporus SPR1 gene, a promoter::GFP fusion cassette was constructed. This expression vector was engineered to contain a 5' intron, which has previously been shown to be necessary for GFP expression in A. bisporus and C. cinerea (6). Plasmid pGreen_hph1_SPR_GFP was transformed into A. bisporus via A. tumefaciens, and transformants were recovered on hygromycin selection. Nine transformants were selected for further analysis. The presence of the intact expression cassette, pGreen_hph1_SPR_GFP, was confirmed via PCR. Primers SPR1Fwd (5'-CCGCGCAACATATGTATGTGAGAG-3') and GFPrev (5'-GTGGCGGATCTTGAAGTTCACCTTG-3'), which bind 256 bp downstream from the 5' end of the SPR1 promoter and 234 bp upstream from the 3' end of the GFP gene, respectively, resulted in a 1,226-bp PCR product. Primers GFPFwd (5'-GGCGTGCAGTGCTTCAGCCGC-3') and TrpCRev (5'-GCACTCTTTGCTGCTTGGAC-3'), which bind 222 bp downstream from the 5' end of the GFP gene and 146 bp upstream from the 3' end of the TrpC terminator, resulted in a 665-bp PCR product. Positive amplification of both fragments confirmed the presence of the intact expression cassette. A. bisporus pGreen_hph1_SPR_GFP transformants, wild-type A. bisporus A15, and an A. bisporus strain expressing the plasmid pGR4-4GiGM3' (G26), which contains GFP under the A. bisporus GPDII promoter (6), were inoculated onto a range of media to investigate whether changes in nutrient availability would alter the expression of the proteinase, which is know to be involved in nutrient acquisition. GFP expression was monitored on media rich in ammonia (YMG, MMP, and RA), potato dextrose agar (PDA), and ammonia-free RA containing one of the following sole nitrogen sources: 0.094% (wt/vol) humic fraction, 0.084% (wt/vol) glutamic acid (GA), or 0.5% (wt/vol) skimmed milk power. GFP expression was observed in the pGreen_hph1_SPR_GFP transformants grown on humic fraction, milk, GA, and PDA media, while no GFP expression was observed on YMG, MMP, and RA (Table 1). Figure 1A shows the expression of GFP in an A. bisporus SPR::GFP transformant (TP17) on ammonia-free RA containing 0.094% humic fraction and its repression on standard regeneration media. As expected, the GPD::GFP control transformant (G26) exhibited strong GFP expression on all media, whereas GFP fluorescence was not observed on any media with the wild-type strain (Table 1).

View this table: [in this window] [in a new window]

TABLE 1. Evaluation of GFP fluorescence in A. bisporus and the C. cinerea monokaryon and dikaryon pGreen_hph1_SPR_GFP transformants on different mediaa

View larger version (74K): [in this window] [in a new window]

FIG. 1. (A) GFP expression in the A. bisporus SPR::GFP transformant TP17 when grown on RA with or without 0.094% humic fraction under phase-contrast microscopy and UV light. Actively growing mycelia were examined using 40x objective on a Leitz Dialux 20 research microscope with excitation filters at 450 to 490 nm, a dichroic filter at 510 nm, and an emission filter at 515 nm. The images clearly show GFP fluorescence in TP17 grown on humic fraction, while no fluorescence was observed when grown on RA. (B) Stipe-localized GFP fluorescence in A. bisporus transformant TP196. Fruiting was induced in A. bisporus transformants, and bisected mushrooms were imaged under white light (WL) and blue LED illumination (BL). (a) The images clearly show fluorescence in both the cap and stipe tissues of freshly harvested (day 0) A. bisporus G26 fruiting bodies, expressing GFP under the control of the GPD promoter. (b) In senescing mushrooms (at 3 days postharvest) no GFP expression was observed in a hygromycin-resistant transformant of A15 (no GFP cassette, leftmost mushroom), while GFP expression was clearly detected in the stipe tissue of SPR::GFP transformant TP196 (rightmost mushroom).

Monitoring of SPR1 expression in A. bisporus sporophore development.
Fruiting was induced in A. bisporus transformants and GFP expression was detected using blue LED illumination of bisected mushrooms (Fig. 1B). Transformants for fruiting were selected from a large sample set by fluorometric quantification of GFP activity in mycelia (23) after induction with the humic fraction (10). TP196 was selected as a typical phenotypic representative of transformants, which also exhibited excellent culture and fruiting capabilities. GFP expression was clearly observed in both the cap and stipe tissues of freshly harvested (day 0) A. bisporus G26 fruiting bodies, expressing GFP under the control of the GPD promoter (Fig. 1Ba). In senescing mushrooms (3 days postharvest) no GFP expression was observed in a hygromycin-resistant (control) transformant of A15hph (no GFP cassette, Fig. 1Bb, leftmost mushroom), while GFP expression was clearly detected in the stipe tissue of SPR::GFP transformant TP196 (Fig. 1Bb, rightmost mushroom).

Metered readings (relative fluorescence units [RFU]) for cap and stipe tissues of whole and longitudinally bisected mushrooms of TP196 (SPR::GFP), G26 (GPD::GFP), and A15hph (no GFP cassette) were recorded 3 days postharvest (Fig. 2). GFP activity was substantially elevated in the stipes of senescing mushrooms for the SPR::GFP transformant TP196. The tissue (stipe)-specific expression of GFP in TP196 is consistent with earlier histochemical observations of SPR activity in senescing mushrooms (9). The RFU values recorded for G26 represent the background fluorescence of the fruiting body, while A15hph exhibits a slight increase in RFU compared to G26 due to autofluorescence.

View larger version (12K): [in this window] [in a new window]

FIG. 2. GFP activity in senescing A. bisporus sporophores. Metered readings (in RFU) are presented for cap and stipe tissues of whole and longitudinally bisected mushrooms at 3 days postharvest. The GFP activity was substantially elevated in the stipes of senescing mushrooms for the SPR::GFP transformant TP196 compared to the control transformants, GPD::GFP (G26) and A15hph (no GFP cassette).

Expression profiles of serine proteinases in C. cinerea LT2.
Endogenous proteinase activity was assessed by inoculating LT2 onto ammonium-free RA with or without a 0.5% (wt/vol) milk solution. Clearing zones, indicative of proteinase activity, were only produced on media containing the milk overlay (Fig. 3A). A proteinase expression profile was developed for LT2 grown in broth by measuring the hydrolysis of the synthetic peptide Suc-Ala-Ala-Pro-Phe-pNA. Proteinase activity was observed in LT2 cultures grown in ammonium-free RA containing 0.5% (wt/vol) milk solution after 120 h (0.0259 absorbance units [AU]/ml) and continued to increase until 240 h (1.283 AU/ml) (Fig. 3B). A small decrease in activity was observed at 264 h but increased again at 288 h. Preincubation of the crude enzyme extracts with the serine proteinase inhibitor PMSF resulted in a large decrease in activity (from 1.283 to 0.17 AU/ml at 240 h), thus confirming that the majority of proteinase activity detected belonged to the serine mechanistic class. Little or no proteinase activity was observed in LT2 cultures grown in standard RA media, which is rich in ammonia (Fig. 3B).

View larger version (11K): [in this window] [in a new window]

FIG. 3. Proteinase profiles in C. cinerea. (A) Proteinase plate assay of C. cinerea. Plugs (7 mm) of C. cinerea LT2 were inoculated onto RA and ammonium-free RA plates containing 0.5% (wt/vol) milk solution. Proteinase production was determined by measuring the clearing zone produced around the colony. (B) Expression of serine proteinase activity in culture filtrates during growth of C. cinerea LT2 in RA and ammonium-free RA containing 0.5% (wt/vol) milk solution. Cultures were grown for 264 h, and samples (8 ml) were aseptically removed every 24 h and assayed using the synthetic peptide Suc-Ala-Ala-Pro-Phe-pNA. (C) Proteinase activity during C. cinerea AmutBmut sporophore development as determined using the Suc-Ala-Ala-Pro-Phe-pNA substrate in the presence or absence of inhibitor.

Serine proteinase activity was measured during the primordium, karyogamy, meiosis, immature, mature, and autolysis stages of fruiting body development (Fig. 3C). Activity increased slowly from the primordium stage (1.29 U/g) to the meiosis stage (1.69 U/g), with a slight dip at the immature stage (1.52 U/g), followed by a large increase in activity during the mature development stage (6.32 U/g). Maximum activity was detected in the mature cap (6.32 U/g), followed by a decrease in activity during autolysis (3.45 U/g). Similarly, preincubation of the crude enzyme extracts with the inhibitor PMSF resulted in a large decrease in activity (from 6.32 to 0.34 U/g in the mature cap), demonstrating that the class of proteinase activity detected was serine proteinase (Fig. 3C).

Identification and sequence analysis of homobasidiomycete serine proteinases.
After confirmation of endogenous serine proteinase activity in C. cinerea, identification of the encoding genes was undertaken using the published C. cinerea genome sequence. Two A. bisporus serine proteinases have been previously identified (SPR1 and SPR2), and their sequences were deposited in public databases under accession numbers Y13805 and AJ344211, respectively (30, 31). The predicted molecular masses (Table 2) for full-length SPR1 and SPR2 are considerably larger than the 27-kDa experimental estimates from sodium dodecyl sulfate-polyacrylamide gel electrophoresis and cDNA and N-terminal amino acid sequencing. Mature SPR1 (286 amino acids, 28.29 kDa) and SPR2 (275 amino acids, 27.70 kDa) proteins are much closer to the 27-kDa estimate previously observed (11, 31). BLAST analysis (1) of the A. bisporus SPR1 and SPR2 genes against the C. cinerea database revealed seven genes (CC1G_04562.1, CC1G_10592.1, CC1G_10615.1, CC1G_07792.1, CC1G_10606.1, CC1G_0.3122.1, and CC1G_04470.1) showing significant homology to the serine proteinases. CLUSTAL W alignments of these C. cinerea genes with the A. bisporus SPR1 revealed amino acid sequence identity values ranging between 44 and 61%, while the homology of the SPR2 with the C. cinerea genes ranged between 42 and 55% (Table 3). SPR1 and SPR2 genes have an amino acid identity value of 75%, while the C. cinerea genes have homologies ranging between 31 and 77% (Table 3).

View this table: [in this window] [in a new window]

TABLE 2. Sequence analysis of the A. bisporus and the predicted C. cinerea serine proteinases and promoter regionsa

View this table: [in this window] [in a new window]

TABLE 3. Percentages of amino acid sequence identity between the A. bisporus and predicted C. cinerea serine proteinasesa

Three motifs were identified within the C. cinerea genes that are common to other serine proteinases: the aspartic acid residue (consensus, [STAIV]-X-[LIVMF]-[LIVM]-D-[DSTA]-G-[LIVMFC]-X(2,3)-[DNH]), the histidine residue (consensus, H-G-[STM]-X-[VIC]-[STAGC]-[GS]-X-[LIVMA]-[STAGCLV]-[SAGM]), and the serine residue (consensus, G-T-S-X-[SA]-X-P-X(2)-[STAVC]-[AG]) (31). These residues were conserved between the C. cinerea genes and the A. bisporus SPR1 and SPR2 genes, with the exception of C. cinerea gene CC1G_10606.1, which lacked the serine residue. This suggests that the C. cinerea genes are serine proteinases, and they appear to belong to the subtilisin family.

The probable C. cinerea serine proteinase genes ranged between 346 and 500 amino acids in length (Table 2), and all contained introns. Each intron began with GT and ended with AG, which is a common feature of fungal introns and has been observed in the serine proteinase genes from Acremonium chrysogenum (28), Lecanicillium psalliotae (60), and Arthrobotrys conoides (61). The number of introns varied between 2 and 14 depending on the gene (Table 2), and some conservation of intron position was observed between the C. cinerea genes and SPR2.

The theoretical molecular masses and isoelectric points for the C. cinerea SPR genes range between 35 and 53 kDa and 5.83 and 9.97, respectively (Table 2), while the theoretical molecular masses and isoelectric points are 39.39 kDa and 5.93 for SPR1 and 38.85 kDa and 5.53 for SPR2, respectively (Table 2). A predicted signal peptide was observed in the C. cinerea and A. bisporus serine proteinases, with cleavage occurring either between amino acids 19 and 20, amino acids 20 and 21, or amino acids 21 and 22, suggesting that these enzymes are secreted. Using the highest homology sequences, the predicted secondary structure of these genes is composed of between 20 and 30% helices, 16 to 35% strands, and 42 to 61% loops (Table 2), and analysis of the degree of protein globularity suggests that these enzymes exist as compact (globular) domains.

One kilobase of sequence upstream from the ATG start codon of each gene was analyzed for the presence of regulatory motifs. At least one CreA and several Nit2/AreA regulatory elements were identified in the promoter regions of the C. cinerea and A. bisporus genes (Table 2). No other regions of homology were detected between the promoters.

Analysis of C. cinerea pGreen_hph1_SPR_GFP transformants.
From a preliminary screen of 100 Trp⁺ cotransformants on RA media (rich in ammonia) and on ammonia-free RA containing 0.094% (wt/vol) humic fraction as the sole nitrogen source, 32% of transformants were found to express GFP on the humic fraction, which correlates well with the reported rate of cotransformation (30 to 49% (6). However, GFP expression was not observed on RA media. Four GFP⁺ transformants, nontransformed LT2, and a C. cinerea strain (PG78Gr) expressing GFP under the regulation of the A. bisporus GPDII promoter (24) were selected for further studies. GFP expression was monitored on media rich in ammonia (YMG and RA), PDA, and ammonia-free RA containing either 0.094% (wt/vol) humic fraction, 0.084% (wt/vol) GA, or 0.5% (wt/vol) milk as the sole nitrogen source. LT2 exhibited no fluorescence on any media, while PG78Gr expressed GFP on all of the media. GFP fluorescence was observed in transformants grown on humic fraction, milk, GA, and potato dextrose media, while no GFP fluorescence was observed on RA media (Table 1). The only transformant to exhibit fluorescence on YMG media was T47.

C. cinerea transformants were mated with AT8, and the dikaryons were inoculated onto a range of media and screened for GFP expression. Similar expression profiles were observed for both monokaryons and dikaryons (Table 1). Figure 4A shows C. cinerea transformant T47 monokaryon and dikaryon expression of GFP on ammonia-free RA containing 0.094% (wt/vol) humic fraction and repression of GFP on standard regeneration media.

View larger version (40K): [in this window] [in a new window]

FIG. 4. (A) Expression of GFP in C. cinerea T47 monokaryon and dikaryon on ammonia-free RA containing 0.094% (wt/vol) humic fraction and on standard RA viewed under phase-contrast (PC) microscopy and UV light. Mycelia on actively growing plates were examined microscopically using a 40x objective on a Leitz Dialux 20 research microscope with excitation filters at 450 to 490 nm, a dichroic filter at 510 nm, and an emission filter at 515 nm. The images clearly show GFP fluorescence in both TP47 monokaryons and dikaryons grown on humic fraction, while no fluorescence was observed in transformants grown on RA. (B) Expression of GFP in the C. cinerea developing fruiting body. Fruiting was induced in the dikaryon C. cinerea TP24 mated with AT8, and GFP fluorescence was monitored in the hyphal knot, primordium, karyogamy, meiosis, immature, mature, and autolysis stages of development. Fruiting was induced in C. cinerea AmutBmut, and fruiting body stages were also screened for GFP expression as a control. Samples were viewed under phase-contrast (PC) microscopy and UV light. (C) Schematic illustration of GFP fluorescence under the control of the A. bisporus SPR1 promoter throughout the C. cinerea life cycle.

Monitoring of SPR1 expression in C. cinerea fruiting body development.
Fruiting was induced in the C. cinerea dikaryon strains and the control strain AmutBmut. Different developmental stages of the fruiting body were examined microscopically for fluorescence. Low levels of fluorescence were observed in the hyphal knot (Fig. 4Ba). Fluorescence was also observed in the primordium stage but was not localized (Fig. 4Bb). A similar observation was made for karogamy stage, but GFP localization began to occur at the edge of the forming gill tissue (Fig. 4Bc). GFP appeared more localized at the forming gill tissue during meiosis (Fig. 4Bd), while at the immature stage GFP was observed high up in the stipe close to the cap (Fig. 4Be). In mature sporophores, fluorescence was observed in the cap but was most concentrated at the junction of the stipe and cap (Fig. 4Bf), while fluorescence was reduced in the stipe (Fig. 4Bg). During autolysis, fluorescence was greatly reduced in the cap (Fig. 4Bh) but was concentrated in the stipe tissue (Fig. 4Bi). In the control strain AmutBmut some autofluorescence was observed throughout the different developmental stages. Figure 4C depicts a schematic of GFP fluorescence under the control of the A. bisporus SPR1 promoter throughout the C. cinerea life cycle.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
A. bisporus SPR1 has previously been shown to be significant in both mycelial nutrition and senescence of the mushroom fruit body (8-10). We used an SPR::GFP fusion construct to investigate temporal and developmental expression of SPR1 in A. bisporus and a heterologous host C. cinerea in response to physiological and environmental stimuli. Developmental studies in A. bisporus are still hindered due to the time and containment issues that exist when studying a genetically modified strain. C. cinerea provides a model system for the studies of gene expression throughout mushroom development (47, 59), and heterologous expression of the A. bisporus SPR1 promoter fusion is a further demonstration of the inkcap host utility as a model species.

GFP has been widely used as a reporter molecule or as a fluorescent tag for fusion proteins (53) and is now a valuable tool in the molecular analysis of filamentous fungi (38). The use of GFP in ascomycete fungi has been widely reported (2, 27, 49), and expression in homobasidiomycetes has also recently been achieved (6, 39, 40).

The aim of the present study was to carry out a comparative molecular analysis of serine proteases in both C. cinerea and A. bisporus. To this end, identification of C. cinerea SPR genomic sequences was performed to establish the homology between Agaricus and Coprinus SPR genes. Bioinformatics was used to help predict whether the genes would be regulated in a similar fashion, thus providing evidence for the suitability of C. cinerea as a heterologous host for A. bisporus SPR1. BLAST analysis of the A. bisporus SPR1 cDNA and SPR2 genomic sequence against the C. cinerea database revealed seven genes showing significant homology. Conservation of the aspartic acid, histidine, and serine residues within the genes suggested that they are serine proteinases belonging to the subtilisin family. However, lack of a serine residue at the active site in CC1G_10606.1 suggests that some of these are "pseudogenes" that would be unable to code for active enzymes. Signal peptide analyses were indicative of extracellular activity, and protein globularity infers that the enzymes would exist as compact globular domains. Sequencing of the A. bisporus genome is currently under way (http://www2.warwick.ac.uk/fac/sci/whri/research/agaricusgenome/), which may reveal further SPR homologues.

All of the C. cinerea genes contained introns, with numbers varying between 2 and 14; only two genes had fewer than 10 introns, six of the seven analyzed contained between 11 and 14 introns. Short exons and high intron density in basidiomycetes and the comparatively poor conservation of intron splice sequences compared to other fungi can result in some inaccuracies when intron predictive software is used. This may account for the low number of introns identified in CC1G_10615.1 and CC1G_04470.1.

In A. bisporus, two serine proteinases (SPR1 and SPR2) were isolated from the same cosmid clone, within 30 kb of each other (30). Similarly, three C. cinerea serine proteinases (CC1G_10592.1, CC1G_10606.1, and CC1G_10615.1) lay within 50 kb of each other on the genome, suggesting either local duplication or a common ancestor. Conservation of intron positions observed in these genes is indicative of local duplications.

Endogenous protease activity was investigated in C. cinerea. A preliminarily plate-based assay resulted in a clearing zone around the fungal colonies, thus confirming the presence of proteases in the basidiomycete. As previously demonstrated in A. bisporus (10), little or no serine proteinase activity was detected in C. cinerea cultures grown in ammonia-rich media. Activity was observed in cultures grown on ammonia-free RA containing milk as the sole nitrogen source after 120 h and continued to increase until 240 h, with a slight decrease at 264 h before another increase at 288 h, which may be indicative of the onset of autolysis.

The expression of SPR1 in response to physiological and environmental stimuli was examined by inoculating the A. bisporus and C. cinerea pGreen_hph1_SPR_GFP transformants onto a range of media to investigate whether changes in nutrient availability would alter the expression of the proteinase. At least one CreA and several Nit2/AreA transcription factor-binding sites were identified in both the A. bisporus and C. cinerea SPR promoter sequences, signifying regulation by factors such as carbon and nitrogen sources. Conservation of these sites was not observed across the promoters. Experimental evidence for the regulation of serine proteinases in response to nitrogen sources is provided from C. cinerea biochemical profiles in broth culture; serine proteinase was not detected on ammonia-rich RA media but was observed on ammonia-free RA supplemented with milk. GFP expression was observed in A. bisporus and C. cinerea transformants grown on PDB and on ammonia-free RA containing humic fraction, milk, or glutamate as the sole nitrogen source. GFP expression was not observed on YMG, MMP, or regeneration media (rich in ammonium), with the exception of C. cinerea transformant TP47. GFP expression was observed in TP47 grown on YMG media, which may result from multiple insertion events; however, this expression profile was atypical of the population of C. cinerea transformants analyzed. Expression profiles were similar for both monokaryons and dikaryons. Collectively, these results suggest that both C. cinerea and A. bisporus produce serine proteinases in response to available nitrogen.

Developmental regulation of serine proteinase expression was investigated. Serine proteinase activity has previously been reported during fruiting body development of A. bisporus (9). From stages 2 to 6 of development (23), activity was relatively low, and cap and stipe activities were similar. A. bisporus developmental stages 2 to 6 roughly correspond to the primordium, karyogamy, meiosis, immature, and mature stages of C. cinerea development. In our SPR biochemical assays, activity was relatively low in the first four stages of C. cinerea development but increased rapidly at the mature stage. GFP expression was ubiquitous in the primordium stage, which may be the result of a higher density of cytoplasm in the developing primordium. GFP expression was observed throughout the karogamy and meiosis stages, although localization of fluorescence began to occur at the edge of the forming gill tissue at the karyogamy stage and became more pronounced at the meiosis stage. C. cinerea is described as having a rupthymenial mode of hymenophore development, where the gill is envisaged as widening toward the periphery of the cap as a differentiating front moves into, and differentiates from, the basidiocarp (50). Since the widest part of the gills is at the cap margin, the differentiating front is also moving upward toward the apex of the cap (52). GFP fluorescence was most concentrated at the base of the gills in the karogamy stage and moved upward toward the apex of the cap in meiosis, suggesting that SPR1 promoter activity was enhanced during the development of young tissue, which may be indicative of high protein turnover during cell differentiation. This could also result from autolysis of connective tissue as the gills begin to separate from the stipe, i.e., creating an abscission zone. At the immature stage, GFP was observed high up in the stipe close to the cap. Studies of C. cinerea stipe elongation have revealed that it is variable along its length and that elongation is greatest at the mid-upper portion (the stipe that is enclosed by the developing cap); the apex and base of the stipe shows little elongation (15, 29). The rapid increase in length is chiefly due to cellular elongation (29), but divisions also contribute, with cells doubling in number and increasing six- to eightfold in length (19). The fluorescence observed in the mid-upper stipe demonstrates that the SPR1 promoter is activity upregulated during elongation and is likely to support the elongating stipe by providing free amino acids via protein degradation. The highest activity was recorded in the mature cap, with slightly less activity in the mature stipe, in contrast to the levels recorded for A. bisporus. In the mature fruiting body, GFP fluorescence was observed in the cap but was most concentrated at junction of the stipe and cap. This may result from a high density of cells where younger tissue is still developing resulting in elevated protein turnover. With A. bisporus developmental stage 7, a large increase in activity in the stipe and a small increase in the cap occurs (9), and further increases are observed as stage 7 mushrooms progress to senescence. During C. cinerea autolysis serine proteinase activity decreased and fluorescence was greatly reduced in the cap but was highly concentrated in stipe tissue. Accumulation of serine proteinase in the stipe during autolysis would suggest a role in the export of nutrients from the stipe to the cap tissue during senescence. Similarly in A. bisporus sporophores, the highest SPR::GFP activity was observed in senescing stipe tissues, suggesting that the stipe may act as an "active source" during the export of nutrients to reproductive spore-bearing tissues.

The results reported here confirm that the A. bisporus promoter (SPR1) is able to regulate mycelial serine proteinase production in response to specific nitrogen sources and have demonstrated tissue specific (stipe-localized) expression in detached sporophores. Use of the SPR::GFP fusion construct, coupled with genome data mining, suggests that serine proteinases also play an integral part in the development of C. cinerea sporophores. The approaches developed here should underpin further promoter analysis in these homobasidiomycete mushrooms and may permit characterization of promoter elements that regulate differential expression and nutritional regulation of serine proteinases. Furthermore, C. cinerea has been validated as a potential model for expression and regulation studies of A. bisporus genes.

 
We thank Chris Thorogood for production of the C. cinerea life cycle illustration. We thank Nicholas Royat, who helped screen numerous A. bisporus transformants.

Research at Universities of Bristol and Warwick was funded by grants from BBSRC and DEFRA.

 
* Corresponding author. Mailing address: School of Biological Sciences, University of Bristol, Woodland Rd., Bristol BS8 1UG, United Kingdom. Phone: 44-117-928-7474. Fax: 44-117-331-7985. E-mail: gary.foster{at}bristol.ac.uk

Published ahead of print on 1 December 2008.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
2
2. Amey, R. C., A. Athey-Pollard, C. Burns, P. R. Mills, A. Bailey, and G. D. Foster. 2002. PEG-mediated and Agrobacterium-mediated transformation in the mycopathogen Verticillium fungicola. Mycol. Res. 106:4-11.[CrossRef]
3
3. Bairoch, A., P. Bucher, and K. Hofmann. 1997. The PROSITE database: its status in 1997. Nucleic Acids Res. 25:217-221.[Abstract/Free Full Text]
4
4. Binninger, D. M., C. Skrzynia, P. J. Pukkila, and L. A. Casselton. 1987. DNA-mediated transformation of the basidiomycete Coprinus cinereus. EMBO J. 6:835-840.[Medline]
5
5. Bradford, M. M., and W. L. Williams. 1976. New, rapid, sensitive method for protein determination. Fed. Proc. 35:274-275.
6
6. Burns, C., K. E. Gregory, M. Kirby, M. K. Cheung, M. Riquelme, T. J. Elliott, M. P. Challen, A. Bailey, and G. D. Foster. 2005. Efficient GFP expression in the mushrooms Agaricus bisporus and Coprinus cinereus requires introns. Fungal Genet. Biol. 42:191-199.[CrossRef][Medline]
7
7. Burns, C., K. M. Leach, T. J. Elliott, M. P. Challen, G. D. Foster, and A. Bailey. 2006. Evaluation of Agrobacterium-mediated transformation of Agaricus bisporus using a range of promoters linked to hygromycin resistance. Mol. Biotechnol. 32:129-138.[CrossRef][Medline]
8
8. Burton, K. S., M. E. Love, and J. F. Smith. 1993. Biochemical changes associated with mushroom quality in Agaricus spp. Enzyme Microb. Technol. 15:736-741.[CrossRef]
9
9. Burton, K. S., M. D. Partis, D. A. Wood, and C. F. Thurston. 1997. Accumulation of serine proteinase in senescent sporophores of the cultivated mushroom, Agaricus bisporus. Mycol. Res. 101:146-152.[CrossRef]
10
10. Burton, K. S., J. F. Smith, D. A. Wood, and C. F. Thurston. 1997. Extracellular proteinases from the mycelium of the cultivated mushroom Agaricus bisporus. Mycol. Res. 101:1341-1347.[CrossRef]
11
11. Burton, K. S., D. A. Wood, C. F. Thurston, and P. J. Barker. 1993. Purification and characterization of a serine proteinase from senescent sporophores of the commercial mushroom Agaricus bisporus. J. Gen. Microbiol. 139:1379-1386.[Abstract/Free Full Text]
12
12. Casselton, L. A., and N. S. Olesnicky. 1998. Molecular genetics of mating recognition in basidiomycete fungi. Microbiol. Mol. Biol. Rev. 62:55-70.[Abstract/Free Full Text]
13
13. Chen, S. 2004. Anti-cancer properties of white button mushrooms. Mushroom Sci. 16:25-29.
14
14. Chen, X., M. Stone, C. Schlagnhaufer, and C. P. Romaine. 2000. A fruiting body tissue method for efficient Agrobacterium-mediated transformation of Agaricus bisporus. Appl. Environ. Microbiol. 66:4510-4513.[Abstract/Free Full Text]
15
15. Cox, R. J., and D. J. Niederpruem. 1975. Differentiation in Coprinus lagopus. III. Expansion of excised fruit-bodies. Arch. Microbiol. 105:257-260.[CrossRef][Medline]
16
16. Cummings, W. J., M. Celerin, J. Crodian, L. K. Brunick, and M. E. Zolan. 1999. Insertional mutagenesis in Coprinus cinereus: use of a dominant selectable marker to generate tagged, sporulation-defective mutants. Curr. Genet. 36:371-382.[CrossRef][Medline]
17
17. de Groot, M. J., P. Bundock, P. J. Hooykaas, and A. G. Beijersbergen. 1998. Agrobacterium tumefaciens-mediated transformation of filamentous fungi. Nat. Biotechnol. 16:839-842.[CrossRef][Medline]
18
18. Eastwood, D. C., M. P. Challen, C. Zhang, H. Jenkins, J. Henderson, and K. S. Burton. 2008. Hairpin-mediated down-regulation of the urea cycle enzyme argininosuccinate lyase in Agaricus bisporus. Mycol. Res. 112:708-716.[CrossRef][Medline]
19
19. Eilers, F. I. 1974. Growth regulation in Coprinus radiatus. Arch. Microbiol. 96:353-364.[CrossRef]
20
20. Elliott, T. J. 1997. Mushrooms. Soc. Gen. Microbiol. Q. 1997:8-9.
21
21. Elliott, T. J., K. S. Burton, and M. P. Challen. 2001. Molecular farming. OECD Workshop, La Grande Motte, France.
22
22. Granado, J. D., K. KerteszChaloupkova, M. Aebi, and U. Kües. 1997. Restriction enzyme-mediated DNA integration in Coprinus cinereus. Mol. Gen. Genet. 256:28-36.[CrossRef][Medline]
23
23. Hammond, J. B. W., and R. Nichols. 1976. Carbohydrate metabolism in Agaricus bisporus (Lange) Sing: changes in soluble carbohydrates during growth of mycelium and sporophore. J. Gen. Microbiol. 93:309-320.[Abstract/Free Full Text]
24
24. Heneghan, M. N., A. Costa, M. P. Challen, P. R. Mills, A. Bailey, and G. D. Foster. 2007. A comparison of methods for successful triggering of gene silencing in Coprinus cinereus. Mol. Biotechnol. 35:283-296.[CrossRef][Medline]
25
25. Higgins, D., J. Thompson, and T. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
26
26. Hooykaas, P. J. J., C. Roobol, and R. A. Schilperoort. 1979. Regulation of the transfer of Ti plasmids of Agrobacterium tumefaciens. J. Gen. Microbiol. 110:99-109.[Abstract/Free Full Text]
27
27. Horowitz, S., S. Freeman, and A. Sharon. 2002. Use of green fluorescent protein-transgenic strains to study pathogenic and nonpathogenic lifestyles in Colletotrichum acutatum. Phytopathology 92:743-749.[CrossRef][Medline]
28
28. Isogai, T., M. Fukagawa, H. Kojo, M. Kohsaka, H. Aoki, and H. Imanaka. 1991. Cloning and nucleotide sequences of the complementary and genomic DNAs for the alkaline protease from Acremonium chrysogenum. Agric. Biol. Chem. 55:471-477.[Medline]
29
29. Kamada, T., and T. Takemaru. 1977. Stipe elongation during basidiocarp maturation in Coprinus macrorhizus: mechanical properties of stipe cell wall. Plant Cell Physiol. 18:831-840.[Abstract/Free Full Text]
30
30. Kingsnorth, C. S., and K. S. Burton. 1998. Genetic regulation of sporophore senescence, p. 94-98. In L. J. L. D. Van Griensven and J. Visser (ed.), Proceedings of the Fourth Meeting on Genetics and Cellular Biology of Basidiomycetes. Mushroom Experimental Station, Horst, The Netherlands.
31
31. Kingsnorth, C. S., D. C. Eastwood, and K. S. Burton. 2001. Cloning and postharvest expression of serine proteinase transcripts in the cultivated mushroom Agaricus bisporus. Fungal Genet. Biol. 32:135-144.[CrossRef][Medline]
32
32. Kües, U. 2000. Life history and developmental processes in the basidiomycete Coprinus cinereus. Microbiol. Mol. Biol. Rev. 64:316-353.[Abstract/Free Full Text]
33
33. Kües, U., and Y. Liu. 2000. Fruiting body production in basidiomycetes. Appl. Microbiol. Biotechnol. 54:141-152.[CrossRef][Medline]
34
34. Lazo, G. R., P. A. Stein, and R. A. Ludwig. 1991. A DNA transformation-competent Arabidopsis genomic library in Agrobacterium. Bio/Technology 9:963-967.[CrossRef][Medline]
35
35. Leach, K., V. Odon, C. Zhang, H. K. Kim, J. Henderson, P. Warner, M. Challen, and T. Elliott. 2004. Progress in Agaricus bisporus transformation: Agrobacterium methodologies and development of novel marker genes. Mushroom Sci. 16:93-102.
36
36. Liu, D., S. Coloe, R. Baird, and J. Pederson. 2000. Rapid mini-preparation of fungal DNA for PCR. J. Clin. Microbiol. 38:471.[Free Full Text]
37
37. Liu, Y., P. Srivilai, S. Loos, M. Aebi, and U. Kües. 2006. An essential gene for fruiting body initiation in the basidiomycete Coprinopsis cinerea is homologous to bacterial cyclopropane fatty acid synthase genes. Genetics 172:873-884.[Abstract/Free Full Text]
38
38. Lorang, J. M., R. P. Tuori, J. P. Martinez, T. L. Sawyer, R. S. Redman, J. A. Rollins, T. J. Wolpert, K. B. Johnson, R. J. Rodriguez, M. B. Dickman, and L. M. Ciuffetti. 2001. Green fluorescent protein is lighting up fungal biology. Appl. Environ. Microbiol. 67:1987-1994.[Free Full Text]
39
39. Lugones, L. G., K. Scholtmeijer, R. Klootwijk, and J. G. H. Wessels. 1999. Introns are necessary for mRNA accumulation in Schizophyllum commune. Mol. Microbiol. 32:681-689.[CrossRef][Medline]
40
40. Ma, B., M. B. Mayfield, and M. H. Gold. 2001. The green fluorescent protein gene functions as a reporter of gene expression in Phanerochaete chrysosporium. Appl. Environ. Microbiol. 67:948-955.[Abstract/Free Full Text]
41
41. May, G., L. Le Chevanton, and P. J. Pukkila. 1991. Molecular analysis of the Coprinus cinereus mating type A factor demonstrates an unexpectedly complex structure. Genetics 128:529-538.[Abstract]
42
42. Mikosch, T. S., B. Lavrijssen, A. S. Sonnenberg, and L. J. van Griensven. 2001. Transformation of the cultivated mushroom Agaricus bisporus (Lange) using T-DNA from Agrobacterium tumefaciens. Curr. Genet. 39:35-39.[CrossRef][Medline]
43
43. Money, N. P., and J. P. Ravishankar. 2005. Biomechanics of stipe elongation in the basidiomycete Coprinopsis cinerea. Mycol. Res. 109:627-634.[CrossRef][Medline]
44
44. Moore, D., and P. J. Pukkila. 1985. Coprinus cinereus: an ideal organism for studies of genetics and developmental biology. J. Biol. Educ. 19:31-40.
45
45. Murzin, A. G., S. E. Brenner, T. Hubbard, and C. Chothia. 1995. SCOP: a structural classification of proteins database for the investigation of sequences and structures. J. Mol. Biol. 247:536-540.[CrossRef][Medline]
46
46. Namekawa, S., F. Hamada, S. Ishii, Y. Ichijima, T. Yamaguchi, T. Nara, S. Kimura, T. Ishizaki, K. Iwabata, A. Koshiyama, H. Teraoka, and K. Sakaguchi. 2003. Coprinus cinereus DNA ligase I during meiotic development. Biochim. Biophys. Acta Gene Struct. Expr. 1627:47-55.[Medline]
47
47. Namekawa, S. H., K. Iwabata, H. Sugawara, F. N. Hamada, A. Koshiyama, H. Chiku, T. Kamada, and K. Sakaguchi. 2005. Knockdown of LIM15/DMC1 in the mushroom Coprinus cinereus by double-stranded RNA-mediated gene silencing. Microbiology 151:3669-3678.[Abstract/Free Full Text]
48
48. Nielsen, H., J. Engelbrecht, S. Brunak, and G. von Heijne. 1997. A neural network method for identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Int. J. Neural Syst. 8:581-599.[CrossRef][Medline]
49
49. Poggeler, S., S. Masloff, B. Hoff, S. Mayrhofer, and U. Kuck. 2003. Versatile EGFP reporter plasmids for cellular localization of recombinant gene products in filamentous fungi. Curr. Genet. 43:54-61.[Medline]
50
50. Reijnders, A. F. M. 1979. Developmental anatomy of Coprinus. Persoonia 10:383-424.
51
51. Romaine, C. P. 2002. Gene transfer technology for mushrooms: the power and potential for significant crop improvement. Mushroom News 50:4-14.
52
52. Rosin, I. V., J. Horner, and D. Moore. 1985. Differentiation and pattern formation in the fruit body cap of Coprinus cinereus, p. 333-352. In D. Moore, L. A. Casselton, D. A. Wood, and J. C. Frankland (ed.), Developmental biology of higher fungi. Cambridge University Press, Cambridge, United Kingdom.
53
53. Schmid, J. A., and H. Neumeier. 2005. Evolutions in science triggered by green fluorescent protein (GFP). Chembiochem 6:1149-1156.[CrossRef][Medline]
54
54. Skrzynia, C., D. M. Binninger, J. A. Alspaugh, and P. J. Pukkila. 1989. Molecular characterization of Trp1, a gene coding for tryptophan-synthetase in the basidiomycete Coprinus cinereus. Gene 81:73-82.[CrossRef][Medline]
55
55. Stothard, P. 2000. The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. BioTechniques 28:1102-1104.[Medline]
56
56. Swamy, S., I. Uno, and T. Ishikawa. 1984. Morphogenetic effects of mutations at the A and B incompatibility factors in Coprinus cinereus. J. Gen. Microbiol. 130:3219-3224.[Abstract/Free Full Text]
57
57. Tyas, D. A., T. Pratt, T. I. Simpson, J. O. Mason, and D. J. Price. 2003. Identifying GFP-transgenic animals by flashlight. BioTechniques 34:474-476.[Medline]
58
58. Velco, A. J., R. W. Kerrigan, L. A. MacDonald, M. P. Wach, C. Schlagnhaufer, and C. P. Romaine. 2004. Expression of novel genes in Agaricus bisporus using an Agrobacterium-mediated transformation technique. Mushroom Sci. 16:591-598.
59
59. Yamaguchi, T., S. H. Namekawa, F. N. Hamada, N. Kasai, T. Nara, K. Watanabe, K. Iwabata, T. Ishizaki, S. Ishii, A. Koshiyama, S. Inagaki, S. Kimura, and K. Sakaguchi. 2004. Expression of flap endonuclease-1 during meiosis in a basidiomycete, Coprinus cinereus. Fungal Genet. Biol. 41:493-500.[CrossRef][Medline]
60
60. Yang, J., X. Huang, B. Tian, H. Sun, J. Duan, W. Wu, and K. Zhang. 2005. Characterization of an extracellular serine protease gene from the nematophagous fungus Lecanicillium psalliotae. Biotechnol. Lett. 27:1329-1334.[CrossRef][Medline]
61
61. Yang, J., J. Li, L. Liang, B. Tian, Y. Zhang, C. Cheng, and K. Q. Zhang. 2007. Cloning and characterization of an extracellular serine protease from the nematode-trapping fungus Arthrobotrys conoides. Arch. Microbiol. 188:167-174.[CrossRef][Medline]
62
62. Zhang, C., V. Odon, H. K. Kim, M. P. Challen, K. S. Burton, D. Hartley, and T. J. Elliott. 2004. Mushrooms for molecular pharming. Mushroom Sci. 16:611-617.
63
63. Zolan, M. E., and P. J. Pukkila. 1986. Inheritance of DNA methylation in Coprinus cinereus. Mol. Cell. Biol. 6:195-200.[Abstract/Free Full Text]

---

Applied and Environmental Microbiology, February 2009, p. 792-801, Vol. 75, No. 3
0099-2240/09/$08.00+0     doi:10.1128/AEM.01897-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Kilaru, S., Collins, C. M., Hartley, A. J., Bailey, A. M., Foster, G. D. (2009). Establishing Molecular Tools for Genetic Manipulation of the Pleuromutilin-Producing Fungus Clitopilus passeckerianus. Appl. Environ. Microbiol. 75: 7196-7204 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Heneghan, M. N. Articles by Foster, G. D. Search for Related Content PubMed PubMed Citation Articles by Heneghan, M. N. Articles by Foster, G. D. Agricola Articles by Heneghan, M. N. Articles by Foster, G. D.