Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AEM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Applied and Environmental Microbiology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AEM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Journal Article | Research Support, Non-U.S. Gov't

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

M Muniesa-Pérez, J Jofre, A R Blanch
M Muniesa-Pérez
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
J Jofre
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
A R Blanch
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 
  • Article
  • Info & Metrics
  • PDF
Loading

ABSTRACT

A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus.

PreviousNext
Back to top
Download PDF
Citation Tools
Identification of Vibrio proteolyticus with a differential medium and a specific probe.
M Muniesa-Pérez, J Jofre, A R Blanch
Applied and Environmental Microbiology Jul 1996, 62 (7) 2673-2675; DOI:

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Applied and Environmental Microbiology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Identification of Vibrio proteolyticus with a differential medium and a specific probe.
(Your Name) has forwarded a page to you from Applied and Environmental Microbiology
(Your Name) thought you would be interested in this article in Applied and Environmental Microbiology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Identification of Vibrio proteolyticus with a differential medium and a specific probe.
M Muniesa-Pérez, J Jofre, A R Blanch
Applied and Environmental Microbiology Jul 1996, 62 (7) 2673-2675; DOI:
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
  • Info & Metrics
  • PDF

Related Articles

Cited By...

About

  • About AEM
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #AppEnvMicro

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

 

Print ISSN: 0099-2240; Online ISSN: 1098-5336