Article Figures & Data
Figures
- Fig. 1.
Dot blot analyses showing the specificity of the oligonucleotide probes for their targets. (A) Genomic DNAs (left dots) and PCR-amplified 16S rDNAs (right dots) of B. subtilis, V. fischeri, and V. anguillarum were blotted together on three replicate membranes and hybridized with the specific probes Bsu, Van, and Vfi, respectively. (B) PCR-amplified 16S rDNAs of mutagenized plasmids Eco(GC), Eco(AT), and Eco(AT)m were blotted on two separate membranes and hybridized with the specific probes Eco and EcoM, respectively. The electronic image was taken from X-ray film exposed for 5 h.
- Fig. 2.
Effect of gene dosage as determined by amplification with different template ratios of Eco(AT) and Eco(AT)m and quantification of product ratios by quantitative dot blotting with probes Eco and EcoM. Regression analysis showed that the relationship between template and product ratios was linear. The vertical bars indicate standard deviations.
- Fig. 3.
Alignment of the sequences of universal amplification primers 27F and 1492R and their target regions on the 16S rRNA genes ofB. subtilis, V. fischeri, andV. anguillarum. The two primers each contain a single degeneracy (between C and T and between C and A, respectively). In theB. subtilis gene both priming sites contain a G at the degenerate site, which most likely results in a higher melting temperature for the primer-target duplex than the melting temperature for the two Vibrio genes, which contain an A and a T at the two positions.
Tables
- Table 1.
Designations and targets of amplification primers and hybridization probes
Primer or probe Sequencea Positionsb Target Primers 27F AGAGTTTGATC(C/A)TGGCTCAG 8–27 (Eu)bacterial 16S rDNA 27F(A) AGAGTTTGATC A TGGCTCAG 8–27 (Eu)bacterial 16S rDNA containing T at position 19 27F(C) AGAGTTTGATC C TGGCTCAG 8–27 (Eu)bacterial 16S rDNA containing G at position 19 1492R TACGG(C/T)TACCTTGTTACGACTT 1492–1513 (Eu)bacterial 16S rDNA 1492R(T) TACGG T TACCTTGTTACGACTT 1492–1513 (Eu)bacterial 16S rDNA containing T at position 1497 1492R(C) TACGG C TACCTTGTTACGACTT 1492–1513 (Eu)bacterial 16S rDNA containing C at position 1497 Probes Bsu CGCGGGTCCATCTGTAAGTG 219–238 B. subtilis 16S rDNA Van CCTAGGCATATCCTGACGCG 219–238 V. anguillarum 16S rDNA Vfi CCTGGGCTAATCTTAGCGCG 219–238 V. fischeri 16S rDNA Eco CTTTACTCCCTTCCTCCCCG 443–462 E. coli mutagenized 16S rDNA with C [Eco(GC)] or A/T [Eco(AT)] in priming regions EcoM CTTTACTGGGAAGCTCCCCG 443–462 E. coli mutagenized 16S rDNA with A/T in priming region and nucleotides 450 to 455 exchanged [Eco(AT)m] Eubc GCTGCCTCCCGTAGGAGT 338–355 (Eu)bacterial 16S rDNA - Table 2.
Comparison of 16S rDNA gene template and PCR product ratios in simultaneous PCR amplifications of three bacterial genomes with degenerate primersa
Prepn Species ratiosb B. subtilis/ V. fischeri B. subtilis/ V. anguillarum V. fischeri/ V. anguillarum Genomic mixture 1.0 ± 0.06 1.0 ± 0.08 1.0 ± 0.07 PCR mixture 2.3 ± 0.18 3.2 ± 0.29 1.4 ± 0.13 PCR 1 2.3 ± 0.12 3.7 ± 0.18 1.6 ± 0.09 PCR 2 2.2 ± 0.13 3.2 ± 0.21 1.4 ± 0.09 PCR 3 2.5 ± 0.17 3.2 ± 0.31 1.3 ± 0.12 PCR 4 2.0 ± 0.15 3.5 ± 0.35 1.8 ± 0.15 PCR 5 3.5 ± 0.25 3.5 ± 0.30 1.0 ± 0.08 ↵a The data were generated by dot blotting and hybridization with species-specific probes of equal amounts of template DNAs from the three species (genomic mixture), a mixture of 10 replicate PCR amplifications (25 cycles) performed with the genomic mixture (PCR mixture), and a subsample of 5 of the 10 replicate PCR amplifications (PCR 1 to 5).
↵b Means ± standard deviations were calculated from data for nine replicate dots for each of the samples which was hybridized with the specific probes and quantified by phosphorimaging. Subsequently, the PCR product signals were normalized to the genomic mixture signal by using a constant factor for each species pair (see text).
- Table 3.
Effect of primer degeneracies on PCR product ratiosa
Prepn Eco(GC)/Eco(AT)m ratiob 15 cycles 25 cycles 35 cycles Template mixture 1.0 ± 0.04 1.0 ± 0.04 1.0 ± 0.04 PCR 1 1.4 ± 0.16 1.5 ± 0.06 2.3 ± 0.10 PCR 2 1.4 ± 0.14 1.8 ± 0.11 2.3 ± 0.07 PCR 3 1.3 ± 0.11 1.7 ± 0.07 2.5 ± 0.20 PCR 4 1.4 ± 0.26 1.9 ± 0.07 1.9 ± 0.14 PCR 5 1.3 ± 0.16 1.8 ± 0.09 2.0 ± 0.17 ↵a The data were generated by dot blot hybridization by using the template-specific probes Eco and EcoM and mixtures containing equal amounts of templates Eco(GC) and Eco(AT)m. PCR products were amplified from the same template mixtures for 15, 25, and 35 cycles.
↵b Means ± standard deviations were calculated from data for three replicate dots for each of the samples which was hybridized with the specific probes and quantified by phosphorimaging.
- Table 4.
Reproducibility of PCR amplification of a single template in a complex mixture of nucleic acids from a natural communitya
Prepn V. anguillarum/(eu)bacterial 16S rDNA ratiob 10% V. anguillarum 1% V. anguillarum 0.1%V. anguillarum PCR 1 0.156 ± 0.008 0.017 ± 0.001 NDc PCR 2 0.147 ± 0.011 0.020 ± 0.000 ND PCR 3 0.153 ± 0.005 0.016 ± 0.001 ND ↵a The data were generated by dot blot hybridization by using the V. anguillarum-specific probe Van219 and the universal (eu)bacterial probe S-D-Bact-0338-a-A-18. PCR products were amplified from nucleic acids extracted from a natural community to which known amounts ofV. anguillarum DNA were added.
↵b Means ± standard deviations were calculated from data for three replicate dots for each of the samples which was hybridized with the specific probes and quantified by phosphorimaging.
↵c ND, not detected (below detection limit).
- Table 5.
Effect of lower number of cycles of the PCR on skewing of product ratiosa
Prepn Species ratiosb B. subtilis/ V. fischeri B. subtilis/ V. anguillarum V. fischeri/ V. anguillarum Genomic mixture 1.0 ± 0.05 1.0 ± 0.06 1.0 ± 0.05 PCR mixture, 10 cycles 1.7 ± 0.10 2.2 ± 0.10 1.3 ± 0.04 PCR mixture, 5 cycles 1.3 ± 0.15 1.5 ± 0.14 1.1 ± 0.05 ↵a The data were generated by dot blotting and hybridization with species-specific probes containing equal amounts of template DNA from the three species (genomic mixture) and a mixture of 10 replicate PCR amplifications (5 and 10 cycles).
↵b Means ± standard deviations were calculated from data for eight replicate dots for each of the samples which was hybridized with the specific probes and quantified by phosphorimaging.
