Article Figures & Data
Figures
- Fig. 1.
Detection of the C1 toxin gene amplification products in DNA samples isolated from sediments collected at botulism outbreak and nonoutbreak sites. (A) ToxC-384/850R/625 primer combination; (B) ToxC-625/1049R/850R primer combination. Images were generated with Photoshop version 5.02 and Freehand version 7.02 software. Letters and numbers above the lanes are sample designations. NTC, no-template control.
- Fig. 2.
Detection of the C1 toxin gene in strain 96 SAC bacterial cells or spores added to sediment sample K7A prior to DNA extraction and purification. Images were generated with Photoshop version 5.02 and Freehand version 7.02 software.
Tables
- Table 1.
Oligonucleotide primers for PCR analysis of the C. botulinum C1 toxin gene
Direction Primera Sequence Sense ToxC-384 5′384AAACCTCCTCGAGTTACAAGCCC406 3′ ToxC-625 5′625CTAGACAAGGTAACAACTGGGTTA648 3′ Antisense ToxC-850R 5′850GAAAATCTACCCTCTCCTACATCA827 3′ ToxC-1049R 5′1049AATAAGGTCTATAGTTGGACCTCC1026 3′ - Table 2.
Detection of the C1 toxin gene in sediments collected from outbreak and nonoutbreak wetlands
Status Wetland complex Wetland sample No. of samples in which product was detected/total no. of samples Outbreak Kulm WMD Km1 2/2a Sutter NWR Su20 3/3a Klamath NWR K4C 1/1b K7A 5/6b K9 1/1b Total 12/13 Nonoutbreak Kulm WMD Km2 1/2a Sutter NWR Su19 3/3a Total 4/5
