Article Figures & Data
Figures
- Fig. 1.
Dot blot hybridization and ARDRA of 16S rDNA clones. Three hundred fifty-three clones were screened by dot blot hybridization with different probes. The diversity within each group was further investigated by ARDRA with one restriction endonuclease (HaeIII). The filled bars represent the numbers of clones detected with specific probes, and the open bars show the numbers of different ARDRA patterns after digestion with HaeIII. Probe GP is specific for gram-positive bacteria (28), ALF968 is specific for members of the α subclass of Proteobacteria(35), CF319 is specific for theCytophaga-Flavobacterium group (30), Gamma598 targets three gene clusters affiliated with sulfur-oxidizing bacteria in the γ subclass of Proteobacteria, Sval428 is specific for psychrophilic sulfate reducers isolated from the same site (48), probe 660 targets Desulfobulbus species (5), 687 is specific for Desulfovibrio and some species of Geobacteraceae (5), and 804 targetsDesulfobacter, Desulfobacterium, andDesulfobotulus species (5). “EUB338 only” indicates the clones which hybridized only with the universal eubacterial probe (1). No EUB338 signal describes clones with a correctly sized insert of 1.5 kb but no hybridization signal at all.
- Fig. 2.
Distribution of 16S rDNA clone sequences in different ARDRA patterns. The profiles are based on ARDRA and sequence analysis. The closest cultivated relatives (rel.) for the individual ARDRA groups are indicated.
- Fig. 3.
Phylogenetic tree showing the affiliations of 16S rDNA clone sequences to selected reference sequences of the δ subclass ofProteobacteria. The tree was calculated by neighbor-joining analysis and corrected with filters which considered only 50% conserved regions of the 16S rRNA of δ-Proteobacteria. 16S rDNA clone sequences are in boldface type. The bar represents 10% estimated sequence divergence.
- Fig. 4.
Phylogenetic tree showing the affiliations of 16S rDNA clone sequences with selected reference sequences of the γ subclass of Proteobacteria. The tree was calculated by neighbor-joining analysis and corrected with filters which considered only 50% conserved regions of the 16S rRNAs of γ-Proteobacteria. Sva0862 and Sva0854 are not full-length sequences (1,000 bp) and have therefore been added to the existing tree, by a special algorithm included in the ARB software, without allowing for changes of the tree topology based on almost complete sequences. 16S rDNA clone sequences are in boldface type. The bar represents 10% estimated sequence divergence.
- Fig. 5.
Rarefaction curves for the different ARDRA patterns of 16S rDNA clones. Rarefaction curves were calculated by using the analytical approximation algorithm described by Hurlbert (18) and 95% confidence intervals estimated as described by Heck et al. (16). The number of different ARDRA patterns in the clone library was determined after digestion with one restriction endonuclease. The expected number of ARDRA patterns (●) is plotted versus the number of clones. Rarefaction curves were also calculated for the fraction of SRB (○). The dotted lines represent 95% confidence intervals.
Tables
- Table 1.
Oligonucleotide probes used in this study
Probe Specificity Sequence (5′→3′) Positiona Td (°C) Reference EUB338 Bacteria GCTGCCTCCCGTAGGAGT 338–355 57 1 ALF968 α subclass of the Proteobacteria, several members of the δ subclass of Proteobacteria, and most Pelobacter-Geobacterspp. GGTAAGGTTCTGCGCGTT 968–985 58 35 687 Desulfovibrio and some species ofGeobacteriaceae TACGGATTTCACTCCT 687–702 48 5 660 Desulfobulbus GAATTCCACTTTCCCCTCTG 660–679 56 5 804 Desulfobacterium,Desulfobacter, Desulfobotulus,Desulfosarcina,Desulfococcus CAACGTTTACTGCGTGGA 804–821 52 5 Sval428 Desulfotalea,Desulfofustis CCATCTGACAGGATTTTAC 428–446 56 48 GP Most gram-positive bacteria Unpublished 41 28 CF319a Cytophaga-Flavobacteriumcluster TGGTCCGTGTCTCAGTAC 319–336 58 30 Gamma598 16S rDNA clone sequences affiliated with endosymbionts and some other species in the γ subclass ofProteobacteria CGGATGTGAAAGCCCTGG 598–615 58 This study ↵a Position in the 16S rRNA of E. coli.
