Article Figures & Data
Figures
- Fig. 1.
TaqMan probes used in this study. Shown are the positions of reporter (R) and quencher (Q) of probes S8807 (A) and S8807A (B) and alignment with complementary strands of target sequences in Synechococcus (Syn.) sp. strains BO 8807, BO 8808, BO 9404, and BO 8805. Mismatches are in boldface and in italics.
- Fig. 2.
Ethidium bromide-stained PCR products from end point TNAs. Two-microliter volumes were analyzed in a 1% agarose gel. Lanes: M, λ DNA digested with PstI; 1 to 4, DNAs fromSynechococcus sp. strains BO 8807, BO 8808, BO 8805, and BO 9404; 5, A. variabilis strain ATCC 29413; 6,Synechocystis sp. strain BO 8402; 7, Microcystissp.; 8, E. coli strain K-12; 9, Anabaena sp. strain PCC 7120; 10, no-template control; 11 to 14,Synechococcus spp. Assay mixtures (25 μl) contained 0.625 U of Taq polymerase and primers PITSANF and PITSEND (200 nM each), amplifying the ITS-1 in the ribosomal operon of many cyanobacteria. The assay mixtures analyzed in lanes 1 to 9 contained 10 ng of DNA, 1.5 mM Mg2+, and 20 nM probe S8807. The assay mixtures analyzed in lanes 11 to 14 contained 1 ng of DNA, 2.5 mM Mg2+, and 50 nM probe S8807A. Templates were amplified in 30 cycles using a two-step PCR program (3 min of annealing and polymerization at 59°C, denaturation at 94°C).
- Fig. 3.
Melting curves of probes S8807 and S8807A. The melting behavior of two TaqMan probes hybridizing to template DNAs fromSynechococcus spp. strains BO 8807 and BO 8808 was analyzed by end point TNA. PCR conditions: 1 ng of template DNA, 50 nM probe (S8807 or S8807A), 2.5 mM Mg2+, 0.625 U of Taqpolymerase, 50 nM primers PITSANF and PITSEND at annealing-extension temperatures of 56 to 65°C, 200 nM at 66 and 67°C, 400 nM at 68 and 69°C, and 800 nM at 70°C. Cycling conditions: 1.5 min of annealing-polymerization, 30 cycles.
- Fig. 4.
Quantification of DNA from Synechococcus sp. strain BO 8807 by end point TNA. Twenty-five-microliter Taqnuclease assay mixtures contained 10−3 to 103ng of DNA, representing approximately 3 × 102 to 3 × 108 genome copies of Synechococcus sp. strain BO 8807; 50 nM primers PITSANF and PITSEND; 50 nM probe S8807A; 2.5 mM Mg2+; and 0.625 U of Taq polymerase. PCR conditions: annealing-polymerization at 60°C for 1.5 min, 30 cycles. The insert shows a 1% agarose gel containing 2 μl of each assay mixture per lane. PCR products were stained with ethidium bromide. Lanes M, λ DNA digested with PstI.
- Fig. 5.
Standard curves obtained by theCT method in real-time PCR. For TNA, 25-μl assay mixtures contained approximately 100 to 107 (108) copies of genomes, 12.5 μl of TaqMan universal PCR master mix (5 mM [final concentration] Mg2+), 300 nM primers, and 50 nM probe. Target DNA, primers (P), and probes (S) in panel A: A. nidulans, P100PA and P3, S100A. Target DNA, primers, and probes in panel B,Synechococcus sp. strain BO 8807, P8807AP and P8807AM, S8807A. The PCR comprised 45 cycles with 1 min at 60°C for annealing-polymerization and 15 s of denaturation at 95°C. Fluorescence threshold (ΔRQ) = 0.04; s = slope. Amplification efficiency was calculated as follows: ɛc = 10−1/s − 1.
- Fig. 6.
Competitive end point TNA. Assay mixtures contained 1 ng of genomic DNA from Synechococcus sp. strain BO 8807 and 10−3 to 103 ng of DNA fromSynechococcus sp. strain BO 8808, A. nidulans, or herring sperm. The PCR assay conditions comprised 30 cycles with annealing and extension at 60°C (1.5 min), 50 nM primers PITSANF and PITSEND was used for amplification of ITS-1, and 50 nM probe S8807A was used to detect strain BO 8807. Controls: Synechococcus sp. strain BO 8807 only.
- Fig. 7.
For quantitative PCR, a 25-μl TNA mixture contained 1 ng of genomic DNA from Synechococcus sp. strain BO 8807 and 10−3 to 102 ng of DNA from A. nidulans (lanes 1 to 6) or 1 ng of DNA fromSynechococcus sp. strain BO 8807 and A. nidulansalone (lanes 7 and 8, respectively). The assay conditions are described in the legend to Fig. 6. A 2-μl volume of each assay mixture was analyzed on a 1% agarose gel and stained with ethidium bromide. λ DNA digested with PstI was used as molecular size markers (lanes M). Lane C, no-template control.
- Fig. 8.
Real-time competitive PCR (A) and correspondingCT values (B). Assay mixtures contained approximately 103 copies of Synechococcus sp. strain BO 8807 DNA (control) and approximately 100 to 108 copies of Synechococcus sp. strain BO 8809 as a competitor, 300 nM primers P8807AM and P8807PE, 50 nM probe S8807A, and 12.5 μl of TaqMan universal PCR master mix (5 mM [final concentration] Mg2+). The assays were run for 45 cycles with 1 min of annealing and extension at 60°C and 15 s of denaturation at 95°C. The threshold was set to ΔRQ= 0.04. The control was Synechococcus sp. strain BO 8807 only.
- Fig. 9.
Detection of Synechococcus sp. strain BO 8807 DNA in the presence of similar DNA (7% sequence divergence in the ITS-1) using PCR primer P8807AP. Approximately 100 to 108 copies of Synechococcus sp. strain BO 8809 DNA were added to approximately 101 (■), 102(□), or 103 (●) genome copies ofSynechococcus sp. strain BO 8807. The control wasSynechococcus sp. strain BO 8807 only. A 25-μl TNA mixture contained the DNA, 300 nM primers P8807AP and P8807AM, 50 nM probe S8807A, and 12.5 μl of TaqMan universal PCR master mix (5 mM [final concentration] Mg2+). The PCR comprised 45 cycles of 1 min of annealing-polymerization at 60°C and 15 s of denaturation at 95°C. The threshold value ΔRQ was 0.04.
Tables
- Table 1.
Primers and probes used in TNAs
Primer or probea Sequence (5′→3′)b Tm (°C)c Primers PITSANF CGTAACAAGGTAGCCGTAC 50 PITSEND CTCTGTGTGCCAAGGTATC 50 P8807AP CATTCTTGACAAGTTAACCAGTTAGCTG 60 P8807AM CAAGGTTCTGCTGACATTCAAACA 60 P8807PE GTGATCTTGACTGTTGTTCGCTGA 60 P100PA GGTTTAGCTCAGTTGGTAGAGCGC 61 P3 TTGGATGGAGGTTAGCGGACT 60 Probes S8807 R–ATTTGTGCT–QCTCGGCTTTACCCGC 67 S8807A R–TCTCCAGGGCAGCATTGAATCCAG–Q 67 S100A R–CTTTGCAAGCAGGATGTCAGCGGTT–Q 68 ↵a Primers and probes were designed to match complementary sequences in Synechococcus sp. strain BO 8807.
↵b The localization of the fluorescent dyes of the probes is indicated by the letters R (reporter, FAM) and Q (quencher, TAMRA).
↵c Tm was calculated using Primer Express primer design software (see Materials and Methods).
- Table 2.
Comparison of the amount of amplified DNA and the fluorescence signal in end point TNAsa with probes S8807 and S8807A
Expt and templateb Amplified DNA Probed Fluorescence signal Arbitrary areac % Avg arbitrary ΔRQ ± SD % A BO 8807 7.1 92.2 S8807 1.02 ± 0.17 100 BO 8808 7.3 94.8 S8807 0.22 ± 0.06 21.6 BO 8805 7.1 92.2 S8807 0.02 ± 0.04 2.0 BO 9404 7.3 94.8 S8807 0.17 ± 0.04 16.7 A. variabilis NDe ND S8807 0.03 ± 0.02 2.9 BO 8402 4.6 59.7 S8807 0.01 ± 0.03 1.0 Microcystissp. 7.7 100 S8807 0 ± 0.04 0 E. coli 0 0 S8807 0 ± 0.08 0 Anabaena strain PCC 7120 ND ND S8807 0.01 ± 0.03 1.0 None 0 0 S8807 0 B BO 8807 6.2 88.6 S8807A 0.8 ± 0.02 100 BO 8808 5.9 84.3 S8807A −0.01 ± 0.04 BO 8805 5.4 77.1 S8807A −0.03 ± 0.04 BO 9404 7.0 100 S8807A 0.02 ± 0.03 2.5 ↵a See Fig. 2.
↵b Template DNA (10 ng in experiment A, 1 ng in experiment B) was obtained from Synechococcus sp. strain BO 8805, BO 8807, BO 8808, and BO 9404; Synechococcus sp. strain BO 8402; two Anabaena strains; Microcystissp.; and E. coli.
↵c Area of ethidium bromide-stained PCR product (see Materials and Methods).
↵d Probe concentrations, 20 (S8807) and 50 (S8807A) nM.
↵e ND, three PCR products, areas not determined.
- Table 3.
Decrease in amplification efficiency caused by coamplified competitor DNA in a real-time competitive PCRa
Competitor DNA copy no.b AvgKm c ± SD Avg ɛd ± SD 0 0.1012 ± 0.0018 0.7166 ± 0.0036 100 0.0926 ± 0.0031 0.6983 ± 0.0071 101 0.0849 ± 0.0055 0.6793 ± 0.0140 102 0.0901 ± 0.0033 0.6925 ± 0.0076 103 0.0543 ± 0.0021 0.5757 ± 0.0095 104 0.0183 ± 0.0003 0.3143 ± 0.0036 105 0.0094 ± 0.0004 0.1896 ± 0.0068 106 0.0084 ± 0.0000 0.1736 ± 0.0004 107 0.0124 ± 0.0011 0.2364 ± 0.0162 108 0.0120 ± 0.0012 0.2300 ± 0.0181 ↵a See Fig. 8.
↵b All reaction mixtures contained 103 genomic copies of Synechococcus sp. strain BO 8807, which is detected by specific TaqMan probe S8807A, and variable amounts of competitor DNA (Synechococcus sp. strain BO 8809), as indicated. The competitor was not detected by the TaqMan probe (see Fig. 8 for details).
↵c Km was derived from a nonlinear least-squares fit of the PCR between cycles 1 and 35 using the equation ΔRQ (i+1) = ΔRQ i[1 +Km (ΔRQi + Km )−1].
↵d Amplification efficiency at a fluorescence threshold (ΔRQ) of 0.04 was calculated as follows: ɛ =Km (0.04 +Km −1).
