Article Figures & Data
Figures
- FIG. 1.
Cloned artificial 253-bp sequence of the IAC. For the invA PCR assay, a 157-bp IAC was amplified by using primer set 139-141. The underlined italic sequence is the binding sequence of primer 139, and the underlined roman sequence is the binding sequence of primer 141.
- FIG. 2.
Features of a two-row by two-column contingency table with respect to the reference culture method and the alternative PCR method. The derived formulas used for analysis in the validation study are shown below the table. a, number of samples that are both reference positive and PCR positive (true positive); b, number of samples that are reference negative but PCR positive (false positive); c, number of samples that are reference positive but PCR negative (false negative); d, number of samples that are both reference and PCR negative (true negative).
- FIG. 3.
Coamplification of different copy numbers of the IAC (157-bp fragment) and Salmonella genomic DNA (284-bp fragment) by using primer set 139-141. The initial numbers of Salmonella DNA and IAC copies per reaction tube are indicated above the gels. The sizes of the PCR products are indicated at left. Marker X (Roche Diagnostics) was used as the molecular weight standard (MW). Ten microliters of the 25-μl PCR mixture was loaded per well.
- FIG. 4.
Detection probability of the Salmonella PCR assay using primer set 139-141 at serially 10-fold-diluted cell concentrations of serotype Typhimurium phage type DT104 reference strain 51K61. The detection probability was established in the presence of 30 or 300 copies of IAC DNA. Five microliters of 10-fold-diluted cell suspensions (100 to 106 CFU/ml) were used as the template in the PCR. The graph shows a sigmoidal fit of data points generated by 30 repetitive PCRs from six independent experiments.
Tables
- TABLE 1.
Salmonella strains used for inclusivity PCR tests and results of preliminary screening
Serotype (subspecies) Serogroup Total no. of strains No. of strains selected for prescreening No. of strains testing positive with primer set: P1-P2 S18-S19 ST11-ST15 139-141 Enteritidis (I) D1 60 10 10 9 10 10 Typhimurium (I) B 60 10 10 10 10 10 Hadar (I) C2-C3 5 1 1 1 1 1 Virchow (I) C1 5 1 1 1 1 1 Infantis (I) C1 5 1 1 1 1 1 Heidelberg (I) B 5 1 1 1 1 1 Newport (I) C2-C3 5 1 1 1 1 1 Brandenburg (I) B 5 1 1 1 1 1 Saintpaul (I) B 20 1 1 1 1 1 Agona (I) B 5 1 1 1 1 1 Blockley (I) C2-C3 5 1 1 1 1 1 Bovismorbificans (I) C2-C3 5 1 1 1 1 1 Bredeney (I) B 5 1 1 1 1 1 Derby (I) B 5 1 1 1 1 1 Dublin (I) D1 5 1 1 1 1 1 Livingstone (I) C1 5 1 1 1 1 1 Montevideo (I) C1 5 1 1 1 1 1 Paratyphi B (I) B 5 1 1 1 1 1 Senftenberg (I) E4 2 —b — — — — Litchfield (I) C2-C3 2 — — — — — Typhi (I) D1 2 — — — — — 42:r:- (II) T 2 1 1 1 1 1 9,12:z:z39 (II) D 1 1 1 1 1 1 48:d:z6 (II) Y 1 — — — — — 42:b:e,n,x,z15 (II) T 1 — — — — — 30:1,z28,z6 (II) N 1 — — — — — 21:g,z51:- (IIIa) L 1 1 1 1 0 1 47:r:- (IIIa) X 1 — — — — — 18:z4,z32:- (IIIa) K 1 — — — — — 50:z:z52 (IIIb) Z 1 1 1 1 1a 1 47:1,v:z (IIIb) X 1 — — — — — 18:i,v:z (IIIb) K 1 — — — — — 16:z4,z32:- (IV) I 1 1 1 1 1 1 48:g,z51:- (IV) Y 1 — — — — — 11:z4,z23:- (IV) F 1 — — — — — 44:r:- (V) V 1 1 0 0 1a 1 66:z65:- (V) 1 — — — — — 48:z35:- (V) Y 1 — — — — — 45:a:e,n,x (VI) W 1 1 1 1 1 1 1,6,14,25:a:e,n,x (VI) H 1 — — — — — 41:b:1,7 (VI) S 1 — — — — — Total 242 43 42 41 42 43 - TABLE 2.
Salmonella-related strains used for exclusivity PCR tests
Organism No. of strains No. of strains selected for preliminary screening Citrobacter brakii 1 0 Citrobacter diversis 1 1 Citrobacter freundii 19 5 Escherichia coli 16 7 Escherichia fergusonii 1 0 Erwinia herbicola 1 0 Enterobacter aerogenes 4 1 Enterobacter agglomerans 2 1 Enterobacter amnigenus 1 0 Enterobacter asbunae 1 0 Enterobacter asburiae 1 0 Enterobacter cloacae 2 1 Enterobacter gergoviae 2 0 Enterobacter sakazakii 1 0 Enterobacter tarda 1 0 Enterobacter taylorae 2 0 Enterococcus faecalis 3 3 Ewingella americana 1 0 Hafnia alvei 3 1 Klebsiella oxytoca 3 1 Klebsiella pneumoniae 5 4 Kluyvera ascorbata 1 0 Listeria inucua 2 2 Listeria ivanovii 2 1 Listeria monocytogenes 8 3 Micrococcus kristinae 1 0 Morganella morganii 4 1 Obesumbacterium proteus 1 0 Proteus agglomerans 1 0 Proteus mirabilis 4 1 Proteus vulgaris 3 2 Providencia heimbachae 1 0 Providencia stuartii 1 0 Pseudomonas aeruginosa 2 0 Pseudomonas alcaligenes 1 0 Rhanella aquatilis 1 0 Serratia marcescens 3 1 Serratia odorifera 2 0 Shigella boydii 3 3 Shigella flexneri 1 1 Shigella sonnei 1 0 Staphylococcus aureus 4 4 Yersinia enterocolitica 4 1 Total 122 47 - TABLE 3.
Selected primer sets for selectivity tests
Target Primer Sequence Size of PCR product (bp) Annealing temp (°C) Reference oriC P1 TTATTAGGATCGCGCCAGGC 163 55 25 P2 AAAGAATAACCGTTGTTCAC ompC S18 ACCGCTAACGCTCGCCTGTAT 159 58 16 S19 AGAGGTGGACGGGTTGCTGCCGTT Random fragment ST11 AGCCAACCATTGCTAAATTGGCGCA 429 60 1 ST15 GGTAGAAATTCCCAGCGGGTACTG invA 139 GTGAAATTATCGCCACGTTCGGGCAA 284 64 21 141 TCATCGCACCGTCAAAGGAACC - TABLE 4.
Results of the collaborative study validating the reproducibility of the analytical accuracy using primer set 139-141
Laboratory no. Inclusivity (%) Exclusivity (%) Positive predictivity (%) Negative predictivity (%) Analytical accuracy (%) Kappa indexa 1 100 100 100 100 100 1.000 2 94 100 100 92 96 0.926 3 96 97 98 94 96 0.927 4 100 100 100 100 100 1.000 4 98 92 94 97 95 0.903 6b 94 67 65 94 77 0.561 7 100 100 100 100 100 1.000 8 100 100 100 100 100 1.000 9 100 100 100 100 100 1.000 10 91 100 100 88 95 0.889 11 100 100 100 100 100 1.000 12 96 100 100 94 98 0.951 13 94 92 94 92 93 0.854 14 100 100 100 100 100 1.000 15 87 100 100 81 92 0.826 16 100 100 100 100 100 1.000 All 97 96 97 96 96 0.926 All but laboratory 6 97 99 99 96 98 0.952 ↵ a Kappa values of <0.01 indicate no concordance, 0.1 to 0.4 indicate weak concordance, 0.41 to 0.60 indicate clear concordance, 0.61 to 0.80 indicate strong concordance, and 0.81 to 1.00 indicate nearly complete concordance.
↵ b Laboratory 6 was excluded from the final statistical analysis due to a markedly lower Kappa index compared with those of the other laboratories.
- TABLE 5.
Results of classification of strains used in the interlaboratory study (laboratory 6 excluded)
Strain and designation Correct classification of strain (%) Non-Salmonella strains Citrobacter diversis EU-NS25 100.0 Hafnia alvei EU-NS35 93.3 Staphylococcus aureus EU-NS22 100.0 Citrobacter freundii EU-NS24 100.0 Enterobacter cloacae EU-NS32 100.0 Enterococcus faecalis EU-NS3 100.0 Escherichia coli ATCC 25922 97.7 Escherichia coli O128 EU-NS10 100.0 Escherichia coli O157 EU-NS11 100.0 Klebsiella oxytoca EU-NS18 93.3 Klebsiella pneumoniae EU-NS17 100.0 Proteus vulgaris EU-NS28 100.0 Shigella boydii EU-NS38 100.0 Shigella flexneri 2a EU-NS27 100.0 Yersinia enterocolitica EU-NS41 100.0 Serratia marcescens EU-NS36 100.0 Salmonella serotypesa Hadar 99-601 100.0 Enteritidis 00-4 90.9 Bredeney 00-215 100.0 Dublin 98-443 69.7 Blockley 98-1262 100.0 Typhimurium 00-510 100.0 42:b:e,n,x,z15 (II) 98-1308 90.9 18:z4,z32:- (IIIa) 99-1556 97.0 47:1,v:z (IIIb) 00-269 100.0 48:g,z51:- (IV) 98-3722 100.0 66:z65:- (V) K-1354 97.0 1,6,14,25:a:e,n,x (VI) 94-2957 100.0 Controls Negative (TE buffer) 100.0 Positive (serotype Typhimurium 51K61) 100.0 ↵ a Numerals in parentheses indicate subspecies.
