Spatial Distribution and Stability of the Eight Microbial Species of the Altered Schaedler Flora in the Mouse Gastrointestinal Tract

Ramahi B. Sarma-Rupavtarm; Zhongming Ge; David B. Schauer; James G. Fox; Martin F. Polz

doi:10.1128/AEM.70.5.2791-2800.2004

DOI: 10.1128/AEM.70.5.2791-2800.2004

Article Figures & Data

Figures

Tables

Open in new tab
Download powerpoint
Open in new tab
Download powerpoint
FIG. 1.
Distribution of ASF strains in different sections of the GI tracts of three defined-flora C.B-17 mice. The number of total bacterial cells of ASF strains (A), ASF356 (B), ASF457 (C), ASF492 (D), ASF500 (E), ASF361 (F), ASF502 (G), and ASF519 (H) in mouse 1 (solid circles), mouse 2 (open squares), and mouse 3 (open diamonds) are shown. The sections are taken from the esophagus (Esop.) (section E1), stomach (sections S1 and S2), small intestine (sections I1 to I6), ileocecal junction and apical cecum (sections C1 and C2, respectively), and colon (sections L1 to L3).
Open in new tab
Download powerpoint
FIG. 2.
Fecal levels of the ASF strains in three defined-flora C.B-17 mice were determined by QPCR. The numbers of ASF bacteria/g (wet weight) in mouse 1 (white columns), mouse 2 (shaded columns), and mouse 3 (black columns) are shown.
Open in new tab
Download powerpoint
FIG. 3.
Specific PCR products obtained by amplification of fecal DNA extracted from C57BL/6 RF mice using the ASF-specific primers. These mice, which originally harbored the defined flora, were bred and maintained under nonsterile conditions for 3 years. Lanes 1 and 10, 100-bp ladder; lanes 2 to 9, RF fecal pellet DNA amplified with primers specific for ASF356 (417 bp), ASF360 (131 bp), ASF361 (182 bp), ASF457 (95 bp), ASF492 (167 bp), ASF500 (285 bp), ASF502 (427 bp), and ASF519 (429 bp) (expected sizes shown in parentheses), respectively.

Tables

Figures

TABLE 1.

Primer sequences, specificity, rRNA copy number, and QPCR parameters^a for the ASF strains

Strain	Species or group	Primer^b			Standard curve			Specificity^c	No. of operons
Strain	Species or group	Primer^b					Slope	Specificity^c	No. of operons	Intercept
ASF356	Clostridium sp.	356-144F	CGGTGACTAATACCGCATACGG (100)	−3.50	35.83	NH^d	5^e
		356-538R	CCTTGCCGCCTACTCTCCC (100)
ASF360	Lactobacillus sp.	360-81F	CTTCGGTGATGACGCTGG (300)	−3.49	37.26	Both primers hit L. intestinalis and 99-100% identical clones	4^e
		360-189R	GCAATAGCCATGCAGCTATTGTTG (200)
ASF361	Lactobacillus murinus	361-278F	GCAATGATGCGTAGCCGAAC (200)	−3.30	32.97	Both primers hit L. animalis and 99-100% identical clones	6^e
		361-435R	GCACTTTCTTCTCTAACAACAGGG (300)
ASF457	Flexistipes group	457-130F	CCGAAAGGTGAGCTAATGCCGG (100)	−3.77	40.96	NH	14^f
		457-219R	GGGACGCGAGTCCATCTTTC (100)
ASF492	Eubacterium plexicaudatum	492-57F	CTGCGGAATTCCTTCGGGG (100)	−3.72	38.15	NH	4^f
		492-204R	CCCATACCACCGGAGTTTTC (100)
ASF500	Low-G+C-content gram-positive group	500-183F	GTCGCATGGCACTGGACATC (200)	−3.45	34.52	Reverse primer hits environmental clones and human colonic clones	11.2^g
		500-445R	CCTCAGGTACCGTCACTTGCTTC (200)
ASF502	Clostridium sp.	502-195F	CGGTACCGCATGGTACAGAGG (200)	−4.65	48.25	NH	11.2^g
		502-600R	CAATGCAATTCCGGGGTTGG (300)
ASF519	Bacteroides sp.	519-834F	CACAGTAAGCGGCACAGCG (200)	−3.78	38.57	Forward primer hits	5^e
		519-1243R	CCGCTCACACGGTAGCTG (200)			uncultured pig GI and environmental clones, reverse primer hits identical mouse clone

↵ a MgCl₂ concentration used in the QPCR mixtures was 4.0 mM.
↵ b The primer designation (F, forward; R, reverse), sequence, and nanomolar concentration of the primer used in QPCR (in parentheses) are shown.
↵ c Specificity determined by BLAST on 1 July 2003.
↵ d NH, no other hits.
↵ e Estimated by Southern blotting.
↵ f Estimated by QPCR see Materials and Methods.
↵ g Average for Clostridium spp. from Ribosomal RNA Operon Copy Number Database (16).

TABLE 2.

Comparison of the ratios of the ASF strains in different sections of the colon and in fecal matter

Strain	ASF strain ratio^a
	L1			L2			L3			F1
	m1	m2	m3	m1	m2	m3	m1	m2	m3	m1	m2	m3
ASF356	62.4	875.7	54.1	547.6	53.9	46.5	110.6	253.7	142.4	0.1	0.0	0.1
ASF361	1.0	1.0	1.0	1.0	1.0	1.0	1.0	1.0	1.0	1.0	1.0	1.0
ASF457	392.5	738.3	84.9	1,060.7	213.9	190.7	554.4	4,499.1	524.1	0.9	0.7	0.6
ASF492	69.9	966.4	89.9	424.0	10.3	42.5	104.8	113.1	75.5	0.1	0.0	0.3
ASF500	30.1	154.2	7.4	81.0	6.1	8.7	16.7	11.8	8.9	0.3	0.1	0.2
ASF502	675.2	3,632.5	130.5	2,388.8	209.1	289.1	1,022.8	787.6	298.2	7.7	1.2	5.7
ASF519	82.1	324.2	24.6	3,597.2	1,357.4	296.2	4,027.7	2,847.9	826.6	11.4	0.8	2.1

↵ a ASF strain ratio was obtained by dividing the number of bacteria of each ASF strain by the number of ASF361 bacteria in the same section or sample. Sections L1 to L3 were proximal to distal sections of the colon, respectively, and F1 is a fecal sample. The ratios for the three different mice (mouse 1 [m1] to 3 [m3]) are shown.