Article Figures & Data
Figures
- FIG. 1.
Organization of LBA1524HPK-LBA1525RR 2CRS in L. acidophilus NCFM. The disrupted HPK gene is represented by a gray arrow. Putative terminator regions and their calculated free energy are indicated by hairpin structures. The start, the putative ribosome-binding site, the potential promoter, and the transcription start are indicated.
- FIG. 2.
Morphology of L. acidophilus NCFM (A) and NCFM::LBA1524HPK (B) as seen under a phase-contrast microscope. Magnification, ×1,000.
- FIG. 3.
(A) Survival of L. acidophilus NCK1398 (NCFM::lacL, squares) and the HPK mutant NCK1686 (circles) in MRS adjusted to pH 3.5 with lactic acid. (B) Cells were exposed to pH 5.5 (open symbols) or pH 6.8 (filled symbols) for 1 h prior to challenge at pH 3.5 (adjusted with lactic acid).
- FIG. 4.
Organization of the oligopeptide transport (opp) operons in L. acidophilus NCFM. Predicted rho-independent terminators with a free energy over −10 kcal/mol (continuous line) and under −10 kcal/mol (dotted line) are indicated.
- FIG. 5.
Growth of L. acidophilus NCFM (squares) and NCK1686 (NCFM::LBA1524HPK [circles]) in milk (solid symbols) and milk supplemented with yeast extract (open symbols) (A) and in milk supplemented with 0.25% Casamino Acids (B). r = 0.99.
- FIG. 6.
(A) Northern blot analysis of seven genes was performed with RNA isolated in three independent experiments from L. acidophilus NCK1398 (NCFM::lacL) and NCK1686 (NCFM::LBA1524HPK) exposed to pH 6.8, 5.5, or 4.5 for 30 min. RNA ratios were calculated by densitometry analysis from data obtained from the Northern blot. (B) Comparison of expression measurements by microarray and Northern blot analysis. The correlation coefficient for each condition is given in the figure.
Tables
- TABLE 1.
Primers utilized for probe generation in Northern blot analysis
ORF Description Primer Orientationa Sequence (5′ to 3′)b LBA0197 ABC transporter, oligopeptide-binding protein OppA1 F GCAGCATGTAGTAGTAATAA R CAGAATCACGTAATGTGTAA LBA1300 Oligopeptide ABC transporter, substrate-binding protein OppA2 F ATGCAATAGCTTGACGAAGA R ATGCAATATGGTGCTGAATC LBA1524 Two-component sensor histidine kinase F GATCTCTAGA-CAGCGCTCTAGCA R GATCAGATCT-TCGGCCAATGTG LBA1525 Two-component system regulator F GATCTCTAGA-CACGAACCGTCTT R GATCAGATCT-TTGGCTCGATTTG LBA0698 Glyceraldehyde-3-phosphate dehydrogenase F TCGTAGTTGACGGTAAGAAG R ACCTGCAGTAGTTACCATAG LBA1075 Malolactic enzyme F GTTGTTACAGACGGTGAAGG R TAATGCACGACCATCAGTCC LBA1196 RNA polymerase sigma factor RpoD F GATCTCTAGA-TTCCGCTTCTTACT R GATCAGATCT-ATCTGACGAATACG - TABLE 2.
ORFs differentially expressed in the HPK mutant (NCK1686) compared to the control L. acidophilus NCK1398 (NCFM::lacL) under different pH conditionsa
COGb functional classification/gene Relative mRNA ratio (HPK/WT)c pH 6.8 pH 5.5 pH 4.5 Amino acid transport and metabolism [E] LBA0111 putative ABC transporter (glutamine), ATP-binding protein 0.36 0.47 0.57 LBA0112 putative ABC transporter (glutamine), substrate-binding protein 0.53 0.71 0.83 LBA0197 ABC transporter, oligopeptide-binding protein oppA1 6.22 4.43 1.92 LBA0198 ABC transporter, oligopeptide-binding protein oppA1B 7.42 1.96 1.59 LBA0200 ABC transporter, oligopeptide permease protein oppB1 6.70 6.31 1.67 LBA0201 ABC transporter, oligopeptide permease protein oppC1 7.27 8.09 2.55 LBA0202 oligopeptide ABC transporter, ATP-binding protein oppD1 7.44 7.09 3.89 LBA0203 oligopeptide ABC transporter, ATP-binding protein oppF1 8.01 7.10 5.57 LBA0849 diaminopimelate epimerase 1.30 2.15 0.91 LBA0850 aspartokinase/homoserine dehydrogenase 1.33 1.89 0.79 LBA0911 aminopeptidase pepC 1.79 1.79 0.72 LBA0943 cationic amino acid transporter 2.94 2.90 1.51 LBA1042 ABC transporter (glutamine) membrane-spanning permease 0.93 0.44 0.71 LBA1044 ABC transporter (glutamine) membrane-spanning permease 0.91 0.47 0.72 LBA1045 ABC transporter (glutamine) ATP-binding protein 0.78 0.39 0.82 LBA1046 ABC transporter (glutamine) substrate-binding protein 0.84 0.43 0.71 LBA1080 putative methionine synthase metK 6.96 5.51 4.32 LBA1086 amino acid permease 3.44 1.73 1.64 LBA1135 macrolide efflux protein 1.12 2.00 1.21 LBA1211 homoserine kinase khsE 1.84 1.67 1.32 LBA1212 homoserine dehydrogenase hdh 2.25 1.50 1.20 LBA1300 oligopeptide ABC transporter, substrate-binding protein oppA2 0.35 0.47 0.36 LBA1301 oligopeptide ABC transporter, substrate-binding protein oppA2B 4.92 1.74 1.37 LBA1302 oligopeptide ABC transporter, permease protein oppC2 1.29 2.14 1.43 LBA1303 ABC transporter, oligopeptide permease protein oppB2 1.50 1.98 1.49 LBA1305 oligopeptide ABC transporter, ATP-binding protein oppF2 1.50 2.00 1.33 LBA1306 oligopeptide ABC transporter, ATP-binding protein oppD2 1.24 2.22 1.35 LBA1341 branched-chain amino acid aminotransferase ILVE 2.13 1.08 1.26 LBA1515 peptidase T pepT 2.26 2.05 1.32 LBA1665 oligopeptide ABC transporter, substrate-binding protein 0.38 0.15 0.58 LBA1837 cytosol nonspecific dipeptidase pepD/A 1.03 1.55 3.10 LBA1961 oligopeptide ABC transporter, substrate-binding protein 2.05 1.91 1.08 Carbohydrate transport and metabolism [G] LBA0600 xylulose-5-phosphate/fructose phosphoketolase 1.31 3.22 0.78 LBA1467 beta-galactosidase large subunit (lactase) 0.07 0.17 0.27 LBA1468 beta-galactosidase small subunit 0.17 0.43 1.05 LBA1777 PTS system, fructose-specific enzyme II 0.98 1.26 0.41 LBA1778 fructose-1-phosphate kinase 1.00 1.30 0.29 LBA1779 transcriptional repressor (fructose operon) 0.92 1.32 0.35 LBA1870 maltose phosphorylase 0.67 0.90 0.21 LBA1872 oligo-1,6-glucosidase 0.97 0.88 0.46 Inorganic ion transport and metabolism [P] LBA0319 ABC transporter, ATP-binding protein 1.19 1.06 1.88 LBA0320 ABC transporter, ATP-binding protein 1.25 0.87 1.96 LBA0321 ABC transporter, permease protein 1.34 1.33 2.21 LBA0904 outer membrane lipoprotein precursor 2.11 2.11 1.19 LBA0905 ABC transporter, ATP-binding protein 2.08 2.07 1.40 LBA0906 ABC transporter, permease protein 1.99 2.88 2.19 LBA1683 cation-transporting ATPase 7.95 1.92 1.83 Signal transduction mechanisms [T] LBA0149 hypothetical protein 1.28 1.01 0.56 LBA0403 hypothetical protein 1.01 1.30 1.21 LBA1081 autoinducer-2 production protein luxS 1.69 2.27 1.51 LBA1524 two-component sensor histidine kinase 1.17 2.82 0.97 LBA1525 two-component system regulator 2.09 1.54 1.03 Defense mechanisms [V] LBA0074 ABC transporter, ATP-binding and permease protein 2.27 0.96 1.07 LBA0075 ABC transporter, ATP-binding and permease protein 3.01 3.90 2.94 LBA1838 ABC transporter, ATP-binding protein 1.55 4.15 7.37 LBA1839 putative permease 1.48 5.16 8.72 LBA1876 ABC transporter, ATP-binding/membrane-spanning protein 1.79 1.98 1.59 Posttranslational modification, protein turnover, chaperones [O] LBA0165 neutral endopeptidase pepO 2.91 3.28 1.97 LBA1512 proteinase P precursor prtP 7.53 7.02 1.58 LBA1564 putative membrane protein 1.42 1.47 2.08 Cell wall/membrane/envelope biogenesis [M] LBA0018 unknown 0.90 1.00 0.55 LBA1469 UDP-glucose 4-epimerase 0.18 0.51 0.67 Transcription [K] LBA1840 transcriptional regulator (TetR/AcrR family) 1.33 3.52 12.60 General function prediction only [R] LBA0367 putative receptor 1.04 1.74 1.26 Energy production and conversion [C] LBA0463 acetate kinase 2.31 1.12 1.27 Translation, ribosomal structure, and biogenesis [J] LBA0672 putative phosphate starvation induced protein yvyD 1.12 0.93 0.43 Intracellular trafficking, secretion, and vesicular transport [U] LBA1496 putative fibrinogen-binding protein 3.56 2.35 1.22 Replication, recombination, and repair [L] LBA1565 unknown 2.02 1.43 1.37 Function unknown/general function prediction only [S], [R] LBA0555 myosin-crossreactive antigen 1.05 0.98 0.43 LBA0872 putative membrane protein 2.14 5.27 2.97 LBA1119 putative inner membrane protein 4.22 3.46 6.24 LBA1869 beta-phosphoglucomutase 0.69 0.70 0.24 LBA1952 hypothetical protein 1.07 0.89 2.26 No COG found LBA0352 hypothetical protein 0.94 0.87 0.47 LBA0402 unknown 1.01 0.81 1.38 LBA0404 hypothetical protein 0.88 0.60 0.95 LBA1495 putative fibrinogen-binding protein 1.62 0.97 1.15 LBA1611 surface protein fmtB 0.56 0.93 0.94 LBA1690 putative membrane protein 1.62 1.32 2.34 ↵ a Array ratios from two biological replicates and two technical replicates for each condition were averaged.
↵ b COG, clusters of orthologous groups (37). Genes were classified according to the COG domain present in the potentially encoded protein sequence; letters in brackets are COG functional category codes.
↵ c Values in boldface indicate ratios that meet the P criteria (P < 0.05).
