Article Figures & Data
Figures
- FIG. 1.
Phylogenetic relationships of Siberian permafrost isolates and selected relatives. Strains studied are shown in boldface. The sequence of Arthrobacter globiformis DSM 20124T was used as an outgroup. Bootstrap values greater than 50% are shown. Accession numbers of previously published sequences are indicated in parentheses. The “T” indicates type strains.
- FIG. 2.
Organization of IS elements residing in the genome of Exiguobacterium sp. strain 255-15. The ORFs are represented as cross-hatched (orfA) and open (orfB) boxes; the direction of the transcription is indicated. The black boxes at each end represent the left (IRL) and right (IRR) terminal inverted repeats. (A and B) ISEsp1 (A) and ISEsp2 (B), both are IS605 elements; (C) ISEsp3 from IS3 family; (D) ISEsp4 from IS30 family.
- FIG. 3.
Southern hybridization analysis of genomic DNAs from Exiguobacterium strains. EcoRI-digested genomic DNA was resolved on 0.8% agarose gel, transferred to nylon membrane, and hybridized with the corresponding probe as described in Materials and Methods. Unless otherwise indicated, bacteria were grown at 24°C. The ORF designation and size of probe are indicated on the right-hand side. Lane 1, DNA molecular weight marker II digoxigenin-labeled, 0.12 to 23.1 kbp (Roche). Lanes 2 to 15 are Exiguobacterium strains, as follows: 2, strain 7-3; 3, strain 7-3 grown at 4°C; 4, strain 7-3 after eight cycles of freeze-thawing and subsequent growth at 24°C; 5, strain 5138; 6, strain 5138 grown at 4°C; 7, strain 190-11; 8, strain 190-11 grown at 4°C; 9, strain 255-15; 10, strain 255-15 grown at 4°C; 11, E. aurantiacum DSM 6208; 12, E. aurantiacum DSM 6208 grown at 4°C; 13, E. antarcticum DSM 14480; 14, E. undae DSM 14481; 15, E. acetylicum DSM 20416.
Tables
- TABLE 1.
Strains of the genus Exiguobacterium included in this study
Straina Source Reference(s) Exiguobacterium sp. strains 7-3 and 5138 Permafrost sample (20,000 years old) from 8 m of borehole 6Kh-Yu, Khomus-Yuryakh River, northeast Siberia, Russia, 68°19′N, 154°58′E; August 1989 22 190-11 Permafrost sample (600,000 years old) from 5.5 m of borehole 5/94, middle part of Bol'shaya Chykochya River, right bank, northeast Siberia, Russia, 69°10′N, 158°4′E; July 1994 24 255-15 Permafrost sample (2 to 3 million years old) from 43.6 m of borehole 2/94, middle part of Bol'shaya Chykochya River, right bank, northeast Siberia, Russia, 69°10′N, 158°4′E; July 1994 24 E. aurantiacum DSM 6208* Alkaline effluent from sodium hydroxide peeling of potato in processing factories 6 E. antarcticum DSM 14480* Microbial mat from the shallow, moated area of Lake Fryxell, McMurdo Dry Valleys region, Antarctica, 77°36′S, 162°6′E; February 1999 3, 8 E. undae DSM 14481* Garden pond in Wolfenbuttel, Lower Saxony, Germany; June 2001 8 E. acetylicum DSM 20416* Creamery waste 7 ↵ a Strains followed by asterisks were obtained from DSMZ GmbH, Braunschweig, Germany.
- TABLE 2.
Primer pairs, positions of amplified fragments, and thermal cycling conditions used in this study
Primera Accession no. Sequences (5′ to 3′) Positions of amplified fragments on chromosomal DNA of strain 255-15b Thermal cycling steps used in PCR Product size (bp) Denaturation Annealing Elongation or0823F AADW01000010 TTCGAAAGAAATCCCAATGC Contig196 position 14723. . .15621 95°C, 60 s 52°C, 60 s 72°C, 90 s 899 or0823R AADW01000010 GACATGTCCATTCACGCAAG or1938F AADW01000039 GAAACTGAACCCTGGCGTAA Contig178 position 18387. . .17483 95°C, 60 s 54°C, 60 s 72°C, 90 s 905 or1938R AADW01000039 CACCGCAAGTACATGTCCAC or1018F AADW01000014 TGACGAGCAAGAATGTCCAG Contig184 position 36355. . .37270 95°C, 60 s 56°C, 60 s 72°C, 90 s 916 or1018R AADW01000014 CCATCAACCACAGGTGCATA or1017F AADW01000014 CCACCGTTTCTCTGATCCAT Contig184 position 35835. . .36169 95°C, 60 s 54°C, 60 s 72°C, 50 s 335 or1017R AADW01000014 TGTTTCGCTCGACACATTTC or0882F AADW01000011 AAATACAGACGCAAAGTGATCG Contig194 position 32455. . .32763, Contig203 position 20830. . .21138 95°C, 60 s 54°C, 60 s 72°C, 50 s 309 or0882R AADW01000011 GTGTCTGATGACGTCGCTTG or0411F AADW01000004 GGAATCTGCATCCTCGAAAA Contig112 position 10037. . .10706, 95°C, 60 s 54°C, 60 s 72°C, 70 s 708 or0411R AADW01000004 GTGCAACACTTCTTCCGTGA Contig172 position 16196. . .16903, Contig184 position 4718. . .5425, Contig196 position 24844. . .25551, Contig200 position 7001. . .7708, Contig203 position 160319. . .161026 or0173F AADW01000001 TCGCTCTTCGAGCTTTCAGT Contig141 position 9091. . .9677, Contig193 position 38093. . .38679, Contig185 position 12469. . .11921, Contig197 position 59520. . .60106, Contig203 position 58478. . .59064 95°C, 60 s 54°C, 60 s 72°C, 70 s 587 or0173R AADW01000001 CGTGACCTCCTCTCGATCTC or0174F AADW01000001 TTGCGGTGAACGGAATCTAT Contig141 position 9877. . .10532, Contig199 position 213. . .869, Contig203 57622. . .58278 95°C, 60 s 54°C, 60 s 72°C, 70 s 657 or0174R AADW01000001 CCAAGCCGTTTAATCGTTGT or1723F AADW01000031 CATTCGCCGTTCATCATCTT Contig81 position 3707. . .4110, Contig176 position 30272. . .30675, Contig184 53340. . .53743, Contig199 position 55267. . .55670 95°C, 60 s 54°C, 60 s 72°C, 50 s 404 or1723R AADW01000031 ATATCGCTCGACGGATTTTC - TABLE 3.
Putative transposases in the genome of Exiguobacterium sp. strain 255-15
IS family Gene IDa Homology groupb G+C content (mol%) Length Product bp aac IS605/IS200 0823*, 0073, 0095, 0413, 0502 I (77.3-90.5) 49.19-51.66 1,173 390 IS605 orfB 0603 I (77.3-90.5) 50.13 1,167 388 IS605 orfB 1900 I (77.3-90.5) 49.47 750 249 IS605 orfB 1938*, 0398, 0692, 2634, 0883, 0012 II (83.8-97.5) 45.69-48.14 1,101 366 IS605 orfB 1122 II (83.8-97.5) 46.18 747 248 IS605 orfB 0987 II (83.8-97.5) 44.97 696 231 IS605 orfB 0988 II (83.8-97.5) 44.92 492 163 IS605 orfB 1018* III (NA) 45.22 1,077 358 IS605 orfB 1017* IV (NA) 42.79 402 133 IS200 0882*, 0011 V (98.0-100.0) 44.86, 45.61 399 132 IS200 IS30 0411*, 2662, 2492, 2494, 1905, 0995, 1141, 0829, 0075, 2913 VI (99.0-100.0) 47.18-47.5 939 312 IS30 0571 VI (99.0-100.0) 47.39 942 313 IS30 2910 VI (99.0-100.0) 46.51 387 128 IS658 IS3 0173*, 0791, 2226, 1202, 1265 VII (86.1-99.7) 43.51-46.76 678 225 IS3, orfA 0174*, 0614 VIII (83.8-100.0) 45.78-45.87 750 249 IS3, orfB 1203, 1266 VIII (83.8-100.0) 45.78-46.2 723 240 IS3, orfB 2227 VIII (83.8-100.0) 47.59 435 144 IS3, orfB 2228 VIII (83.8-100.0) 44.44 342 113 IS3, orfB ISNCY 1723* IX (99.8-100.0) 46.51 516 172 CREd 1032 IX (99.8-100.0) 46.35 561 187 CRE 2917 IX (99.8-100.0) 46.96 939 312 CRE 0657 IX (99.8-100.0) 46.78 1,584 527 CRE ↵ a ORFs used to construct probes are indicated by asterisks. ID, identification number.
↵ b The percent identity between transposase coding nucleotide sequences inside the group is shown in parentheses. ORFs chosen for probe design had more than 82% identity to other ORFs inside the group. NA, not applicable (ORFs are unique and have 20.6 to 26.0% [ORF1018], and 20.9 to 25.9% [ORF1017] identity to others).
↵ c aa, amino acids.
↵ d CRE, cassette chromosome recombinase.
- TABLE 4.
Observed distribution of the transposase coding sequences among Exiguobacterium strains
Transposase Representative ORF Probe size (bp) No. of bandsa for strain: 255-15 7-3 5138 190-11 DSM 6208 DSM 14480 DSM 14481 DSM 20416 IS605, orfB ORF0823 899 6 6 10 5 0 8 5 1 IS605, orfB ORF1938 905 6 (3) 1 (4) 1 (2) ((1)) (2) 1 (1) 1 (1) 0 IS605, orfB ORF1018 916 1 0 0 1 1 1 0 2 IS200 ORF1017 335 1 0 0 1 1 1 0 0 IS200 ORF0882 309 1 (1) 3 1 0 2 0 1 0 IS30 ORF0411 708 7 (6) (4) (2) 5 (1) 0 16 4 (2) 0 IS3, orfA ORF0173 587 5 0 1 0 0 5 1 1 IS3, orfB ORF0174 657 5 0 1 1 0 5 1 1 CREb ORF1723 404 4 0 0 0 0 1 0 0 Total 46 18 18 15 6 39 16 5
