Enzymatic Ability of Bifidobacterium animalis subsp. lactis To Hydrolyze Milk Proteins: Identification and Characterization of Endopeptidase O

Bacterial strains and culture conditions. Escherichia coli strains XL1-Blue (4) and BL21(DE3)pLysS (Novagen, Madison, Wis.) were used as cloning and expression hosts, respectively. Cells were routinely grown at 37°C in Luria-Bertani medium (44) supplemented with 12.5 μg/ml tetracycline, 30 μg/ml kanamycin, 34 μg/ml chloramphenicol, and/or 1 mM isopropyl β-d-thiogalactopyranoside (IPTG) when appropriate. Bifidobacterium animalis subsp. lactis DSM 10140^T was cultured in MRS broth (Pronadisa, Madrid, Spain) and a milk-based medium, which contained 100 g/liter reconstituted skim milk powder (Scharlau, Barcelona, Spain) and 10 g/liter GMP (Lacprodan; Arla Food Ingredients, Denmark). Cells grown in this milk-based medium were propagated first in MRS broth and then in skim milk enriched with 5 g/liter yeast extract and 5 g/liter glucose. All media were supplemented with 0.5 g/liter l-cysteine hydrochloride to lower the redox potential. B. animalis subsp. lactis cultures were incubated at 37°C under anaerobic conditions (Gas-Pack, Anaerogen; Oxoid, Basingstoke, United Kingdom) for 24 h.

Cell fractionation.Cells were collected from MRS broth (1 × 10⁹ CFU/ml) and milk-based medium (4 × 10⁸ CFU/ml) by centrifugation (10,000 × g, 10 min, 4°C). Before centrifugation, the milk culture was neutralized at pH 6.5 with 1 M NaOH and cleared by adding 1% trisodium citrate to cause casein micelle dispersion, as previously described (14). Whole cells were washed with 2 mM Ca²⁺-containing 50 mM Tris buffer, pH 8, and taken to an optical density at 600 nm (OD₆₀₀) of 20. The cell wall-bound fraction (CWF) was obtained by incubating the cell pellet obtained from milk cultures at 25°C for 1 h in 20 mM Bis-Tris buffer, pH 6.0, containing 10 mM EDTA as described by Fernández de Palencia et al. (16). The protein material of the fraction was precipitated with 80% ammonium sulfate and resuspended in 20 mM sodium phosphate buffer, pH 7, after centrifugation (20,000 × g, 5 min, 4°C). Cell extracts (CFE) were obtained from MRS and milk B. animalis subsp. lactis culture pellets using mechanical disruption by mixing cells (1:1) with glass beads (diameter, 150 to 212 μm; Sigma, St. Louis, Mo.) and vortexing the ice-cooled suspensions four times over 4 min. Cell debris and glass beads were collected by centrifugation (12,000 × g, 5 min, 4°C). Protein concentrations were determined as described by Bradford (3) using a commercial reagent (Bio-Rad Laboratories, Hercules, Calif.) with bovine serum albumin as a standard.

Screening for proteolytic activity of B. animalis subsp. lactis with chromogenic substrates.Whole cells, CFE, and CWFs were tested for proteolytic activity with chromogenic substrates. Proteinase activity was examined in whole cells (OD₆₀₀, 20) and CWFs (30 mg/ml). Endopeptidase, X-prolyl-dipeptidyl aminopeptidase, and aminopeptidase activities were determined in CFE (2 mg/ml). The substrates employed (all purchased from Sigma, except for succinyl-Ala-Glu-Pro-Phe-p-nitroanilide [Bachem, Bubendorf, Switzerland] and Universal Protease Substrate [Roche Diagnostics, Mannheim, Germany]) and references for the corresponding methods are listed in Table 1. All enzymatic reactions were performed in 50 mM sodium phosphate buffer, pH 7, at 37°C. Results are expressed as specific activity (units per milligram of protein). One unit of enzyme activity is defined as the amount of enzyme required to release 1 μmol chromogenic substrate per min under the enzyme assay conditions.

Analysis of galactosidase activity.The α- and β-galactosidase activities were measured by employing o-nitrophenyl-α-d-galactopyranoside and o-nitrophenyl-β-d-galactopyranoside (Sigma), respectively. The reaction mixture contained 50 mM sodium phosphate buffer, pH 6.5, 1 mM magnesium chloride, 1 mM 2-mercaptoethanol, 2.32 mM substrate, and CFE (2 mg/ml). The liberation of o-nitrophenol was observed at 410 nm and 37°C, and activity is expressed as units per milligram of protein. One unit is defined as the amount of enzyme that can release 1 μmol of o-nitrophenol per min under the given conditions.

Hydrolysis of milk proteins and casein-derived peptides by B. animalis subsp. lactis.Activities against caseins, whey proteins, GMP, and α_s1-casein(f1-23) were studied with whole cells, CWFs, CFE, and purified recombinant PepO. Whole cells were employed in the reaction mixture at a final OD₆₀₀ of 20, CFE at a final concentration of 2 mg/ml protein, CWFs at 30 mg/ml, and recombinant PepO at 10 μg/ml. Pure α-, β-, and κ-caseins (Sigma) were suspended in 50 mM sodium phosphate buffer, pH 7, and used at a final concentration of 1 mg/ml, while α-lactoalbumin and β-lactoglobulin (Sigma) were used at a final concentration of 0.5 mg/ml. Aliquots were taken from the reaction mixtures after 2, 4, and 24 h of incubation and centrifuged (12,000 × g, 5 min), and the supernatants were mixed 1:1 with solubilization buffer (125 mM Tris buffer, pH 7.5, 20% glycerol, 4% sodium dodecyl sulfate [SDS], 0.01% bromophenol blue, and 10% mercaptoethanol). Samples were denatured (100°C, 5 min), and the hydrolysis products were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) on 15% polyacrylamide gels as described by Laemmli (24). Activities against GMP (Sigma) and α_s1-casein(f1-23) (a gift from P. Fernández de Palencia [15]) were assayed in 50 mM sodium phosphate buffer, pH 6, with 1 mg/ml and 4 mg/ml substrate, respectively. After a 50-min reaction, samples were centrifuged (12,000 × g, 5 min), and the supernatants were heat inactivated (100°C, 5 min). Hydrolysis products were analyzed by reverse-phase high-performance liquid chromatography (RP-HPLC) following the procedures described by Exterkate et al. (12) for α_s1-casein(f1-23) and by Martín-Diana et al. (27) for GMP. Peptides generated by enzymatic hydrolysis were collected and freeze-dried, and the N-terminal amino acid sequence was determined by automated Edman degradation analysis at the Protein Synthesis Laboratory in the Centro de Investigaciones Biológicas (CSIC, Madrid, Spain).

DNA manipulations. B. animalis subsp. lactis chromosomal DNA was obtained as described by Meile et al. (34). E. coli plasmid isolation was done with the GFX Micro Plasmid Prep kit (Amersham Biosciences, Uppsala, Sweden). DNA manipulations and electrotransformation of E. coli cells were carried out by standard methods (44).

Cloning and expression of the endopeptidase gene (pepO). B. animalis subsp. lactis pepO was identified by sequence similarity within a fragment of chromosomal B. animalis subsp. lactis DNA obtained and sequenced in the course of a random genome sampling of B. animalis subsp. lactis (unpublished results). To express the predicted B. animalis subsp. lactis endopeptidase gene in E. coli, a 2.28-kb DNA fragment was amplified by PCR using B. animalis subsp. lactis chromosomal DNA as a template and the primer pair NcoI_for (GAAGCCATGGATACCACTTTGCAATCAGGC)-HindIII_rev (TATCAAGCTTCCAGATGCGCACGCGTTC) (underlined sequences indicate NcoI and HindIII restriction sites, respectively). DNA amplification was performed with Pwo DNA polymerase (Roche) according to the manufacturer's instructions. The NcoI/HindIII-digested PCR product was inserted into the Novagen pET-28a(+) vector. The recombinant plasmid, pET-pepO, encoding the complete endopeptidase gene as well as a C-terminal His₆ tag, was transformed into E. coli BL21(DE3)pLysS. The entire pepO sequence was confirmed by DNA sequencing.

Expression of the B. animalis subsp. lactis pepO gene was induced by adding IPTG (final concentration, 1 mM) to E. coli BL21(DE3)pLysS cells containing pET-pepO and growing them to an OD₆₀₀ of approximately 0.5. For optimal expression, 0.8 mM glucose was also added to the culture medium. After a further 4 h of incubation, the cells were harvested by centrifugation (10,000 × g, 10 min). The production and the cellular localization of the target protein were verified by analysis of total proteins, soluble and insoluble cytoplasmic fractions, and the medium fraction according to the pET System Manual (39). IPTG-induced cultures of E. coli BL21(DE3)pLysS harboring pET-28a(+) were used as a negative control. The protein pattern of cell fractions was monitored by SDS-PAGE (24).

Purification of recombinant PepO.All steps for recombinant protein purification were carried out at 4°C. The induced cell pellet was frozen at −80°C, resuspended in 2 ml/g (wet weight) of binding buffer (0.02 M sodium phosphate, pH 7.4, 0.5 M NaCl, 0.01 M imidazole), and then mixed (1:1, wt/vol) with glass beads to obtain CFE. These CFE were used to purify the recombinant PepO by immobilized metal affinity chromatography (IMAC), employing a 1-ml HiTrap Chelating HP column (Amersham) according to the manufacturer's instructions. The enzyme was eluted with 0.1 M imidazole, and the solution was desalted (PD-10 column; Amersham) and stored in 0.02 M sodium phosphate buffer, pH 6, at −80°C. The molecular mass and purity of the recombinant enzyme were confirmed by native PAGE on 7.5% polyacrylamide gels using a nondenatured protein molecular weight marker (Sigma) as a standard.

Effects of reagents, pH, and temperature.All enzymatic reactions were carried out with bradykinin as the substrate. The purified recombinant PepO was preincubated with various metals and reagents at a 1 mM concentration in 50 mM sodium phosphate buffer, pH 6. The temperature optimum was determined by performing the enzymatic reactions at different temperatures (5 to 55°C), and the pH optimum was measured over pH ranges from 3 to 9 by employing different buffers, namely, sodium acetate (pH 3 to 5), sodium phosphate (pH 6 to 7), and Tris-HCl (pH 8 to 9). Thermostability was analyzed by incubating the enzyme at temperatures between 5 and 55°C and measuring the residual activity under standard conditions. pH stability was determined by incubating the enzyme at different pH values (pH 3 to 9) before measuring residual activity under standard conditions.

Substrate specificity and identification of hydrolysis products.The activity of the recombinant enzyme was measured toward bradykinin, angiotensin, substance P, methyl enkephalin, and methyl enkephalinamide (Sigma) as peptide substrates. Standard enzyme assays in 100 μl were carried out in 50 mM sodium phosphate buffer, pH 6, containing 4 μg/ml recombinant PepO and 0.16 mM peptide. After incubation for 50 min at 37°C, the reaction was stopped with 50 μl 3% trifluoroacetic acid, and the hydrolysis products were analyzed by RP-HPLC as described by Pritchard et al. (40). Hydrolysis of caseins, whey proteins, GMP, and α_s1-casein(f1-23) by the recombinant enzyme was also analyzed as described above. Hydrolysis products were collected, freeze-dried, and identified by amino acid sequencing.

Nucleotide sequence accession number.The entire pepO sequence was confirmed by DNA sequencing and deposited in the GenBank and EMBL databases (accession no. AJ844608 ).

Screening for proteolytic activity of B. animalis subsp. lactis with chromogenic substrates.Proteinase activity was not detected in CWFs or in whole cells with chromogenic substrates. The same negative result was obtained for endopeptidase activity measured with chromogenic substrates in CFE. However, X-prolyl-dipeptidyl aminopeptidase and general aminopeptidase activities could be detected in CFE (Table 2). CFE obtained from cells grown in MRS medium showed no detectable activity, whereas the same experiments performed with CFE obtained from cells grown in milk-based medium showed measurable activities, among which proline iminopeptidase activity was remarkably high. Analysis of galactosidase activities in B. animalis subsp. lactis CFE (Table 2) showed 100-fold-higher α- and β-galactosidase activities in cells grown in milk than in cells grown in MRS. The results indicate that the activities in CFE from MRS-grown cells were below the lowest quantifiable level (0.005 U/mg).

Hydrolysis of milk proteins and casein-derived peptides by B. animalis subsp. lactis.Whole cells, CWFs, and CFE of B. animalis subsp. lactis grown in milk-based medium were incubated with pure α-, β-, and κ-caseins to analyze caseinolytic activity. CFE could hydrolyze casein fractions completely after 4 h of incubation at 37°C as observed by SDS-PAGE analysis. Both β- and κ-caseins were hydrolyzed more rapidly than α-casein (results not shown). CWFs could not degrade caseins even after 24 h of incubation. Whole cells started to degrade caseins only after a 24-h incubation, which could be a result of cell lysis and leakage of intracellular material into the medium. To assess whether the cells were damaged, the corresponding supernatants were analyzed for β-galactosidase activity. The results showed that β-galactosidase activity was detected in the supernatant only in the 24-h-incubated samples. Whey proteins (α-lactoalbumin and β-lactoglobulin) could not be hydrolyzed by any of the cellular fractions analyzed.

Cloning and expression of the endopeptidase gene (pepO) in E. coli and purification of the recombinant protein.The endopeptidase gene of B. animalis subsp. lactis was identified by sequence similarity to the putative B. longum NCC2705 pepO (accession no. NC_004307 ) in the course of a random sampling of the genome of B. animalis subsp. lactis. The predicted B. animalis subsp. lactis endopeptidase gene (deposited under accession no. AJ844608 ) encodes a 693-amino-acid protein with a calculated molecular mass of 78.3 kDa, an isoelectric point of 4.6, and no predicted signal peptide or transmembrane domains, suggesting an intracellular location of the enzyme. The protein shared 67.4% amino acid sequence identity with the predicted endopeptidase of B. longum NCC2705 (accession no. NP_696878 ). A high degree of similarity was also found with predicted metalloendopeptidases from Propionibacterium acnes KPA171202 (YP_056588) (45.7% amino acid identity) and Corynebacterium glutamicum ATCC 13032 (NP_599406) (43.8% amino acid identity). However, the B. animalis subsp. lactis gene displayed relatively low identity with PepO enzymes from lactic acid bacteria (LAB), namely, 31.0%, 29.4%, and 28.5% identity with the PepO enzymes of S. thermophilus A (CAC14579), Lactobacillus helveticus CNRZ32 (O52071), and Lactococcus lactis subsp. lactis (F53290), respectively. The PepO-like endopeptidase of B. animalis subsp. lactis belongs to the M13 peptidase family of zinc metallopeptidases, since it contains all the catalytic signatures that are common to all the enzymes of this family, namely, ⁵⁰²HExxH⁵⁰⁶, ⁵⁷⁴ExxxD⁵⁷⁸, and ⁴⁶⁰vNAfY⁴⁶⁴ (indices correspond to residue numbering in the B. animalis subsp. lactis PepO amino acid sequence).

Overexpression of the pepO gene in E. coli BL21(DE3)pLysS occurred only when glucose was added to the growth medium along with IPTG. SDS-PAGE protein patterns of cellular fractions obtained from the IPTG-induced culture of E. coli BL21(DE3)pLysS cells bearing pET-pepO showed a strong signal at a molecular mass of about 74 kDa within the total protein and the soluble cytoplasmic fractions (Fig. 1). This size is in agreement with the calculated molecular mass (78 kDa) deduced from the predicted PepO sequence. The medium and insoluble cytoplasmic fractions contained only marginal amounts of protein, suggesting that most of the recombinant enzyme was available in a soluble form and thus probably in an active state (results not shown). Analysis of induced cells bearing pET-28a(+) showed no signal at 74 kDa within any fraction, confirming that the strong bands identified above originate from the expression of the cloned gene. As shown in Fig. 1, the C-terminal His₆ tag facilitated the purification to homogeneity of the recombinant PepO by a single IMAC step. Native PAGE of the recombinant protein showed one band with an apparent molecular mass of 74 kDa (results not shown), indicating that B. animalis subsp. lactis PepO is a monomeric enzyme.

• Open in new tab
• Download powerpoint

FIG. 1.

SDS-PAGE analysis of purified protein fraction of IPTG-induced E. coli BL21(DE3)pLysS harboring the recombinant PepO. Lanes: 1, protein standard; 2, soluble cytoplasmic fraction eluted by IMAC with 0.1 M imidazole; 3, cell extract of 0.1 mM IPTG-induced E. coli BL21(DE3)pLysSpET-pepO cells.

Biochemical characterization of the recombinant B. animalis subsp. lactis PepO.For biochemical characterization, B. animalis subsp. lactis recombinant PepO activity toward bradykinin was measured. Optimal temperature and pH were 37°C and 6.5, respectively (results not shown). Residual activity decreased below 35% at pH values lower than 6.5, and no activity was measured below pH 5, while at pH 9 the residual activity was 48% (results not shown). The PepO was significantly inhibited by EDTA and 1,10-phenanthroline (Table 3), both of which are metalloenzyme inhibitors, but was only partially inhibited by phosphoramidon, an agent known to completely inhibit other metalloendopeptidases (48). Thiorphan, another specific inhibitor of endopeptidases, was even less effective at the inhibition of B. animalis subsp. lactis PepO than phosphoramidon (Table 3). Diethyl pyrocarbonate, which inhibits activity by reactivity with the active-site histidine (25), and the serine protease inhibitor phenylmethylsulfonyl fluoride (PMSF) also caused partial inhibition. Dithiothreitol was the only agent that acted as an activator (Table 3), which could be due to its reducing character, whereas p-(hydroxymercuri)benzoic acid, which has an oxidizing effect, reduced the activity.

Since the enzyme was found to have no activity with synthetic chromogenic substrates, the hydrolysis of natural peptides was assessed (Table 4). Relative activities toward the different substrates were determined by following substrate disappearance as a function of time using RP-HPLC. In addition, the hydrolysis products were identified in order to determine the cleavage bond specificity. The predominant peptide bond cleaved by B. animalis subsp. lactis PepO was on the N-terminal side of phenylalanine residues. Main secondary cleavage sites were also at Pro-Xxx bonds. The specific activity of the enzyme was calculated on the basis of the primary cleavage site and before secondary products were released. Regardless of the preferential cleavage bonds, specific activity increased with peptide length, indicating that the enzyme functions as an endopeptidase (Table 4).

With respect to degradation of milk proteins and derived peptides, the pure recombinant PepO was not able to hydrolyze either α-, β-, or κ-casein, α-lactoalbumin, β-lactoglobulin, or GMP. However, α_s1-casein(f1-23), a 23-amino-acid peptide that is present in cheese whey as a consequence of enzymatic hydrolysis of α_s1-casein, was rapidly hydrolyzed by the recombinant enzyme. Hydrolysis of α_s1-casein(f1-23) was recorded during 20-, 40-, and 60-min incubations with PepO at 37°C (Fig. 2). The preferential cleavage site of PepO in α_s1-casein(f1-23) (Table 4) released peptide 3 (f14-23) and peptides 1 and 2, both of which started with the amino-terminal residues of α_s1-casein(f1-23). After 1 h of incubation with the recombinant PepO, little or none of the initial α_s1-casein(f1-23) could be detected, and the peptides originated underwent no further hydrolysis by this enzyme.

• Open in new tab
• Download powerpoint

FIG. 2.

Reverse-phase HPLC patterns of (a) pure α_s1-casein(f1-23) [CN] and its hydrolysis products (peaks 1, 2, and 3) after (b) 20-min, (c) 40-min, and (d) 60-min incubations with Bifidobacterium animalis subsp. lactis recombinant PepO.