Production of Recombinant and Tagged Proteins in the Hyperthermophilic Archaeon Sulfolobus solfataricus

Strains and culture conditions.An S. solfataricus pyrEF mutant (PH1-16) (25) was grown at 80°C and pH 3 in Brock's medium with or without 10 μg ml⁻¹ uracil and with 0.1% tryptone and 0.2% arabinose or as indicated. The optical densities of liquid cultures were monitored at 600 nm (OD₆₀₀).

Plasmid construction.The plasmids used for this study are listed in Table 1. For the construction of pBR05, the genes pyrEF and lacS as well as the promoter region of the Tf55α gene were amplified by using the primers pyrEF-f-AvrII (CGAAATCACCCTAGGGAATAATGC), pyrEF-r-NheI (GTGGTGCTAGCTTCCTCGTGTAG), ptf55-f-AvrII (GCATTATTCCCTAGGGTGATTTCG), ptf55-r-BssHII (GACTGGCGCGCCCATACCTCA), lacS-f-BssHII (TGAGGTATGGGCGCGCCAGTC), and lacS-r-EagI (GCGGTGGCGGCCGGCAATCTAA), with pMJ03 (16) as the DNA template. Because of complementary overlaps of the primers, all PCR products were used as template DNAs in a second PCR using the flanking primers pyrEF-f-AvrII and lacS-r-EagI, thus generating a fragment of 3.6 kbp. The PCR product was purified (using a QIAGEN Gene-Clean kit), restricted with NheI and EagI, and ligated into pBR322 restricted with NheI and EagI. The Sulfolobus-E. coli shuttle vector pMJ05 was constructed by ligating the NheI/EagI fragment of pBR05 to the XbaI/EagI-restricted and dephosphorylated SSV1/pUC18 shuttle vector pMJ02 (16).

The sor gene of Acidianus ambivalens, including a 10-amino-acid-encoding Strep tag at the C terminus, was PCR amplified by using the primers SorN-Strep-BssHII (CTAGATAACGCGCGCAAAAAATGCCG) and SorC-Strep-EagI (CTTCACCGGCCGA GCTTATTAACC). The construct pASK5 (37), containing the sor gene fused to a C-terminal Strep tag, was used as the DNA template. The PCR product was restricted with BssHII and EagI and ligated into pBR05, which yielded vector pBR-sor. This plasmid was cut with NheI and EagI, and the sor gene with the promoter was ligated to XbaI/EagI-restricted and dephosphorylated pMJ02, yielding the Sulfolobus expression vector pMJ05-sor.

An additional restriction site (ApaI) was introduced into pBR05 such that other genes could be introduced by leaving the terminator from lacS in the vector. This was done with a quick mutagenesis kit I (Stratagene). A PCR was performed with the primer ApaIF (GCCATTAAGGCACTAAGGGCCCACTTTCTCAAGTCTC) and its complement ApaIR (containing an ApaI site), with pBR05 as the template, yielding pSVA1. This vector was used as a template to replace the lacS gene with SSO2316 (flaI). The latter was amplified by PCR from the S. solfataricus genomic DNA using the primer pair 2316F (CCCCCGCGCGCCAGTCATGAGCTTTATTGAAGATTAC) and 2316R (CCCCCCGGGCCCTT AATGATGATGATGATGATGAATATTCTTAG), thereby fusing a C-terminal six-His tag to the encoded product. The PCR product was cloned into the BssHII and ApaI sites of pSVA1 to yield pSVA2. For the construction of pSVA5, the promoter region 241 bp upstream of the araS gene (SSO3066) was amplified from S. solfataricus genomic DNA with the primer pair araSF (CCCCCCCTAGGGCACCATATGTTTAGAGATG) and araSR (CCCCCGAATTCGCCATGGTCTCGGGTACTTTTATGACCTAAC), containing a BlnI and an NcoI restriction site, respectively. In the same manner, the lacS gene was amplified with the primer pair lacSF (GGGGGCCATGGACTCATTTCCAAATAGCTTTAG) and lacSR (CCCCCCGGGCCCTTAGTGCCTTAATGGCTTTAC), containing an NcoI and an ApaI restriction site, respectively. The ATG codon in the NcoI site coincided with the start codon of lacS. Both PCR products were digested with NcoI and ligated. The resulting ligation product was digested with BlnI and ApaI and inserted into pSVA1 to yield pSVA5, which contained the lacS gene under the control of the araS promoter.

SSO2680 and SSO0287 were amplified from genomic DNA by PCRs using the primer pairs SSO2680f/SSO2680r and SSO0287f/SSO0287r, respectively. This resulted in the introduction of NcoI and ApaI restriction sites in the flanking regions of these genes and the presence of a C-terminal 10-His tag in SSO2680 and a StrepII tag and 8-His tag at the C terminus of SSO0287. Both genes were cloned into pSVA5 using the NcoI/ApaI sites, yielding pSVA14 and pSVA30, which carried SSO2680 and SSO0287, respectively. To transfer the araS promoter together with the gene to be expressed into the virus-based vector, the BlnI/EagI inserts from pSVA14 and pSVA30 were ligated into pMJ05, resulting in plasmids pSVA15 and pSVA31, respectively.

Transformation of S. solfataricus.Electroporation of S. solfataricus PH1-16 and the isolation of single transformants were done as described previously (16, 31). Integration of the viral vector into the genome was confirmed by Southern analysis using standard procedures.

Expression and purification of Sor.Cells containing the pMJ05-sor construct were grown in 300 ml Brock's medium supplemented with 0.1% tryptone and 0.2% d-arabinose. After 3 days of cultivation, cells (1 g) were harvested by centrifugation and resuspended in 25 ml 10 mM Tris-HCl, pH 8.0. The cells were lysed by sonication, and after centrifugation to remove cell debris and the membrane fraction, the supernatant was used for Streptactin affinity chromatography. Twenty milliliters of supernatant was applied to a Streptactin Superflow column (10 ml; IBA, Göttingen, Germany) connected to a fast-performance liquid chromatography apparatus. Purification was performed according to the manufacturer's instructions. The peak fractions were pooled and concentrated first by ultrafiltration (Centrex UF-2 [cutoff, 30 kDa]; Schleicher & Schuell, Dassel, Germany) and subsequently with a Speed-Vac machine.

Expression of FlaI.Cells containing pSVA6 were inoculated into 50 ml Brock's medium supplemented with 0.1% tryptone and 0.2% arabinose. At an OD₆₀₀ of 0.5, the cells were diluted into 400 ml of the same medium and grown to an OD₆₀₀ of 0.8. Cultures were then shifted to 88°C for 24 to 48 h, and the cells were harvested by centrifugation and resuspended in 10 mM Tris-HCl, pH 8, and 100 mM NaCl. Lysis of the cells and the isolation of membranes were done as described below.

Expression and purification of SSO2680.Cells containing pSVA15 were inoculated into 50 ml Brock's medium containing only 0.1% tryptone. After 2 days of growth (OD₆₀₀, ∼0.5), 10 ml of cells was transferred to 400 ml medium containing 0.1% tryptone and 0.2% arabinose to induce the expression of SSO2680. After 2 days of growth (OD₆₀₀, ∼0.8), the cells were harvested and resuspended in buffer A (50 mM NaP_i, pH 8, 100 mM NaCl, and 5 mM imidazole). Lysis of the cells and the isolation of membranes were done as described below. Membranes were resuspended in buffer A and solubilized with 2% n-dodecyl-d-β-maltopyranoside (DDM) at a protein concentration of 4 mg/ml for 45 min at room temperature. Nonsolubilized protein was removed by high-speed centrifugation, and the supernatant containing the solubilized membrane protein was applied to a His-Select 1-ml column (Sigma) that was preequilibrated with buffer A and 0.05% DDM. The column was washed with 10 volumes of buffer A and 0.05% DDM and subsequently with 3 volumes of 50 mM NaP_i, pH 8, 100 mM NaCl, 30 mM imidazole, and 0.05% DDM. Bound protein was eluted with 1.5 column volumes of 50 mM NaP_i, pH 8, 100 mM NaCl, 250 mM imidazole, and 0.05% DDM. The protein was dialyzed overnight against 20 mM morpholineethanesulfonic acid, pH 6.5, 100 mM NaCl, and 10% glycerol and subsequently frozen in aliquots at −20°C.

Expression and purification of SSO0287.The growth conditions for cells containing pSVA31 were the same as those described for SSO2680. After 2 days of growth (OD₆₀₀, ∼0.8), the cells were harvested and resuspended in 10 mM Tris-HCl, pH 7.5, 100 mM NaCl. The cytoplasmic fraction was applied to a 1-ml His-Select affinity column, and further purification was performed as described for SSO2680, except that DDM was omitted from the buffers. Strep tag-mediated purification was performed with Streptactin columns (IBA Technology) according to the manufacturer's recommendations. The elution buffer contained 100 mM Tris-HCl, pH 8, 150 mM NaCl, 1 mM EDTA, and 2.5 mM desthiobiotin. Gel filtration was performed on a Smart system (Pharmacia), using a Superdex TM 200 PC 3.2/30 column (Amersham Biosciences) with 20 mM Tris-HCl, pH 7.4, and 100 mM NaCl.

Fractionation of cells.Cells were broken by sonication in a Soniprep 150 ultrasonic disintegrator (MSE Scientific Instruments, Crawley, England) (10 cycles of 15 s on and 45 s off), and cell debris was removed by low-speed centrifugation. Membranes were collected by ultracentrifugation for 30 min at 100,000 × g at 4°C.

Activity assays.β-Galactosidase activity was determined as described previously (16). β-Galactosidase activity staining was performed by incubating native gels in a buffer containing 5 mM ONPG (o-nitrophenyl-β-d-galactopyranoside) for 30 min at 75°C. ATPase activity assays were performed with a colorimetric assay (24) as described previously (39).

The Sor activity assay was performed aerobically as previously described (19). Protein aliquots were incubated in 1 ml assay buffer (70 mM Tris-HCl, pH 7.2, 0.1% Tween 20, 2% [wt/vol] sulfur [dispersed by sonication]) at 85°C for different time intervals (0, 4, 8, 12, and 16 min), and the reactions were stopped by cooling on ice. After centrifugation, the products thiosulfate and hydrogen sulfide were examined colorimetrically in the supernatant and quantitated using the respective calibration curves. The reaction velocity was calculated from the linear increase in product concentrations. Since sulfite rapidly reacts to form thiosulfate at 85°C (19), the amounts of thiosulfate and sulfide were quantitated. One unit (U) of enzyme activity was defined as the formation of 1 μmol of thiosulfate (oxygenase activity) or 1 μmol of H₂S (reductase activity) per minute.

Analytical methods.Protein concentrations were determined by the Bradford method (5a), by measuring the OD₂₈₀, or by using an RC protein determination kit (Bio-Rad). Proteins were separated in 10% sodium dodecyl sulfate (SDS) gels (30a) and visualized with colloidal Coomassie blue (Roti-Blue; Roth, Karlsruhe, Germany). Samples (50 μg) of protein from crude cell extracts of transformants were fractionated in nondenaturing blue native gels (30b). Gels (6.5%; 14 × 14 × 0.15 cm) were prepared and run in an SE400 vertical electrophoresis chamber (Hoefer Scientific Instruments). After activity staining with ONPG, the gels were stained with colloidal Coomassie blue for visualization of the protein bands. Matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass fingerprints after tryptic digestion of the proteins were done by the Dencher group at the Clemens Schöpf Institute of Organic Chemistry (Darmstadt, Germany).

Entry vectors and introduction of the sugar-inducible araS promoter.In the recently described shuttle vector pMJ03 (16), the complete DNA of the virus SSV1 (15 kb) was combined with pUC18 for replication/selection in Escherichia coli, the genes pyrEF of S. solfataricus for complementation of uracil auxotrophic mutants of Sulfolobus, and the reporter gene lacS, coding for β-galactosidase. The system was used to show the expression of the β-galactosidase gene (lacS) under the control of the heat-inducible promoter of the α subunit of the thermosome of S. solfataricus (TF55α). This promoter has a strong basal activity and is additionally inducible by shifting cultures from 78 to 88°C. In order to improve the pMJ03-based vector system for the homologous and heterologous expression of genes in S. solfataricus, entry vectors were constructed with restriction sites that allowed us to replace the lacS gene with other genes of interest by cloning them directly behind the promoter sequence. The putative transcriptional terminator sequences of lacS were left intact (Fig. 1). Moreover, the heat-inducible tf55α promoter was replaced with an arabinose-inducible promoter in order to allow the induction of high-level expression without imposing stress on the host cells. For this purpose, a 241-bp region upstream of the open reading frame of araS, encoding the arabinose-binding protein, a subunit of an ABC sugar transporter in S. solfataricus (11), was selected for cloning. In contrast to the original tf55α-lacS promoter-gene fusion in pMJ03, this construct did not contain the five initial codons of the tf55α gene. Instead, the start codon of araS coincided with the start codon of the gene to be expressed (Fig. 1). High-level expression of β-galactosidase, which forms a tetramer of 240 kDa in vivo (28), was demonstrated by the separation of cell extracts of transformants in a nondenaturing blue native protein gel and subsequent activity staining with ONPG (Fig. 2). A quantitative estimation of promoter strengths using the LacS reporter activity showed that the arabinose promoter exhibited a considerably lower basal activity than the tf55α promoter in the absence of an inducer (Table 2). Upon the addition of arabinose to the medium, the activity levels of β-galactosidase increased about 13-fold. The absolute value of 3.3 U/mg protein was comparable to that obtained with the tf55α promoter after heat shock (Table 2, second column). However, transformants with a tf55α promoter that contained an NcoI site at the translation start site (comparable to the situation in the araS construct) exhibited an even higher activity, at ca. 12 U/per mg of protein, in crude extracts (Table 2, construct pMJ11). A more detailed analysis of promoter variants and the effects of mutations on the initiation of transcription and translation is currently in progress.

• Open in new tab
• Download powerpoint

FIG. 1.

Schematic representation of S. solfataricus entry vectors. The diagrams show the regions of the pBR322 vector with the pyrEF gene cassette, the different promoters, and the restriction sites that can be used to clone the gene of interest behind the promoter sequences.

• Open in new tab
• Download powerpoint

FIG. 2.

β-Galactosidase activity monitored in a nondenaturing polyacrylamide gel before and after induction with arabinose. Crude extracts (50 μg of protein) of two independent pSVA9 transformants were separated by blue PAGE 0, 22, and 46 h after the addition of 0.4% arabinose to the growth medium. (Left) ONPG activity staining of β-galactosidase. (Right) Colloidal Coomassie blue-stained gel.

Heterologous expression and purification of the sulfur oxygenase reductase from Acidianus ambivalens.The sulfur oxygenase reductase (Sor) from the chemolithoautotrophic crenarchaeote A. ambivalens is a cytoplasmic enzyme that catalyzes the initial step in the dissimilatory sulfur oxidation pathway in this organism (19, 20). Sulfite, thiosulfate, and hydrogen sulfide are simultaneously produced from elemental sulfur in an oxygen-dependent reaction. Sor is an icosatetrameric protein with a molecular mass of 840 kDa that is composed of identical subunits of 35.2 kDa (38) and contains a mononuclear nonheme iron center as a cofactor (37). S. solfataricus lacks a sor homolog (32).

The sor gene, including codons for a C-terminally fused Strep tag, was cloned under the control of the tf55α promoter. Single transformants of S. solfataricus PH1-16 containing the pMJ05-sor construct were grown at 78°C and subsequently shifted to 88°C to induce the expression of the sor gene. The yield was 0.5 mg of enriched Sor protein per liter of culture after Streptactin affinity chromatography. A band corresponding to a molecular mass of 36 kDa was visible on SDS gels containing the purified protein fraction (Fig. 3A). The protein was confirmed to be identical to the A. ambivalens Sor protein plus the additional amino acids from the Strep tag by MALDI-TOF analysis. Other bands were visible besides the Sor band. A prominent band with an apparent molecular mass of 55 kDa was identified by MALDI-TOF analysis as the large subunit of the biotinylated S. solfataricus acetyl-coenzyme A (acetyl-CoA)/propionyl-CoA carboxylase (also called AccC or SSO2466 [15]). The specific activities in the Sor preparation, measured as the production of thiosulfate and hydrogen sulfide from elemental sulfur, were 4.5 and 1.2 U mg protein⁻¹ (oxygenase and reductase activities, respectively). These values are comparable to those obtained for the enzyme isolated from its native host (Fig. 3B), indicating the successful assembly of the homomultimeric enzyme and the incorporation of the iron cofactor.

• Open in new tab
• Download powerpoint

FIG. 3.

Purification and activity of A. ambivalens Sor isolated from S. solfataricus transformed with pMJ05-sor. (A) SDS-PAGE of different fractions (E1 and E2) eluted from the Streptactin column. M, molecular mass marker proteins. Solid arrow, Sor band; dashed arrow, AccC subunit of the acetyl/propionyl-CoA carboxylase (both identified by MALDI-TOF analysis). (B) Sulfur oxygenase and reductase activities of pooled eluate fractions showing time-dependent increases in the amounts of thiosulfate and hydrogen sulfide in the assay mixture (19). Background, nonenzymatic production of thiosulfate and hydrogen sulfide from sulfur disproportionation under the same assay conditions without the enzyme (19).

Homologous expression of the ATPase FlaI.flaI (SSO2316) is part of the potential flagellin operon of S. solfataricus and encodes a 59-kDa protein with a nucleotide-binding domain. FlaI is homologous to other ATPases present in archaeal flagellin operons, which may fulfill a role in the assembly of the archaeal flagellum. Gene inactivation experiments with Halobacterium salinarium and Methanococcus voltae have previously shown that the FlaI protein is essential for flagellum formation (27, 36). In S. solfataricus, flaI is expressed only in the stationary growth phase (1). The protein was expressed in E. coli earlier, purified to homogeneity, and shown to exhibit divalent cation-dependent ATP-hydrolyzing activity (1). In order to produce FlaI in Sulfolobus, the gene, including codons for a six-His tag, was cloned under the control of the tf55α promoter to yield pSVA6. Single transformants containing the vector were isolated and grown at 78°C with a subsequent shift to 88°C. Strain PH1-16 (pyrEF lacS double mutant) was grown as a control. Samples were taken from both cultures at the start of heat incubation and after 1 and 2 days. Cells were harvested, separated into membrane and cytoplasmic fractions, and analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting using antibodies directed against purified FlaI (1). While the heterologously expressed FlaI protein in E. coli had been isolated from the soluble cytoplasmic fraction (1), the protein produced in Sulfolobus could only be detected in the membrane fraction of induced cells (Fig. 4). This observation was confirmed using antibodies directed against the C-terminal His tag of FlaI (data not shown).

• Open in new tab
• Download powerpoint

FIG. 4.

Western analysis of FlaI expression. S. solfataricus cells transformed with pSVA6 and control PH1-16 cells were grown for 2 days at 88°C. Samples were taken at the beginning of the temperature shift from 78 to 88°C and after 1 and 2 days of growth at 88°C. Membranes were isolated from the cells and were analyzed by SDS-PAGE and immunoblotting using FlaI-specific antibodies. The arrow indicates the detected expression product.

Homologous expression and purification of SSO2680.SSO2680 is a hydrophilic nucleotide-binding protein of 59 kDa. It has been shown to be encoded in an operon with five other genes (1) that encode proteins with motifs typically found in subunits of bacterial protein secretion systems. These so-called type II and type IV secretion machineries, as well as type IV pilin assembly systems, are involved in the assembly or secretion of multimeric substrate proteins such as pili. The protein substrate of this putative secretion operon in Sulfolobus is unknown. Interestingly, the operon contains a gene for one small protein of 15 kDa, SSO2681, which contains a type IV pilin signal peptide and might therefore be a subunit of a pilus structure (1). SSO2680 shows sequence similarity to bacterial secretion ATPases, such as Virb11 and PilT, which power the secretion process (30, 42). SSO2680 was cloned behind the araS promoter with codons for a C-terminal 10-His tag and transferred to the viral vector, yielding pSVA15. After transformation of Sulfolobus, single transformants were grown on 0.1% tryptone and subsequently transferred to the same medium supplemented with 0.2% arabinose. After 2 days of growth, cells were harvested, lysed, and separated into membrane and cytoplasmic fractions. These fractions were analyzed by SDS-PAGE and immunoblotting using antibodies directed against the His tag (Fig. 5). Although SSO2680 is predicted to be a soluble protein, it was recovered with the membrane fraction. In E. coli, the protein had been recovered with inclusion bodies, and only a small fraction could be isolated from the soluble fraction (1). SSO2680 was purified from detergent-solubilized membranes of S. solfataricus by His-Select Ni affinity chromatography, yielding ∼1 mg purified enzyme per liter of cells (Fig. 5A). Immunodetection with His tag-specific antibodies confirmed that the purified protein corresponded to the recombinant tagged protein (lower part of Fig. 5A). SSO2680 showed divalent cation-dependent ATPase activity at a high temperature and a preference for Mn²⁺ over Mg²⁺ (Fig. 5B), in agreement with previous studies using the heterologously expressed protein purified from E. coli (1). Interestingly, the specific activity of the protein produced and purified from S. solfataricus was six times higher (50 nmol of P_i released mg protein⁻¹ min⁻¹) than that of the enzyme isolated from E. coli (8 nmol of P_i released mg protein⁻¹ min⁻¹) (1), which indicated a more native conformation of the homologously expressed protein. In order to analyze the effect of medium composition on the expression level, cells were grown with different amounts of tryptone and arabinose, and the membrane and cytoplasmic fractions of lysed cells were analyzed by SDS-PAGE and immunoblotting. The relative yield of recombinant protein did not change when the arabinose concentration was varied between 0.2 and 0.4%. Although the amount of tryptone affected the growth rate, it did not affect the expression level (data not shown). We occasionally observed very high expression levels, comparable to those obtained with E. coli expression systems, in different transformants of Sulfolobus. One such example is shown for SSO2680 in Fig. 5C. The conditions which led to these increased expression levels are currently under investigation.

• Open in new tab
• Download powerpoint

FIG. 5.

Overexpression, purification, and activity of SSO2680. (A) Coomassie blue-stained SDS-PAGE gel of His tag-specific affinity chromatography fractions from solubilized membranes derived from S. solfataricus cells transformed with pSVA15. In the lower panel, the corresponding Western blot of the same samples, using His tag-specific antibodies, is shown. M, molecular mass marker; St, starting material; FT, flowthrough; W, wash; E, elution fraction. (B) ATPase activity of purified SSO2680 in the presence of EDTA, Mg²⁺, or Mn²⁺. (C) Overexpression of SSO2680. Membranes of a single pSVA15 transformant were separated in a Coomassie blue-stained SDS-PAGE gel before (−) and after (+) induction with 0.4% arabinose. The arrow indicates SSO2680. In the lower panel, the corresponding Western blot of the same samples, using His tag-specific antibodies, is shown.

Expression of SSO0287.SSO0287 (or ABCE1) is a cytoplasmic protein of 68 kDa that contains two nucleotide-binding domains and is predicted to harbor two iron-sulfur clusters. It is homologous to eukaryotic ABC proteins that are essential for cell function and involved in ribosome biogenesis and protein translation (18, 43) but whose specific function is unknown.

The gene was cloned behind the araS promoter with codons for a C-terminal tandem tag, including a Strep tag followed by an eight-His tag. Single transformants were grown on 0.1% tryptone and subsequently transferred to medium containing both 0.1% tryptone and 0.2% arabinose. After 2 days, cells were harvested and lysed. The cytosolic fraction was applied to either a Streptactin or His-Select Ni affinity column. Both methods resulted in single-step purification of the tagged protein (Fig. 6). The identity of the protein was verified by means of immunoblotting using antibodies directed against the Strep tag and the His tag and polyclonal antibodies directed against ABCE1 itself. The purified protein exhibited divalent cation-dependent ATPase activity, with a high temperature optimum of 85°C, close to the optimal growth temperature of S. solfataricus (S. Dinkelaker and R. Tampé, manuscript submitted). As described above, SSO0287 contains two putative sites for the binding of iron-sulfur clusters. Previous attempts to obtain correct assembly of these clusters by heterologous expression in E. coli failed (unpublished results), whereas the homologously produced protein in S. solfataricus appeared to contain the iron-sulfur clusters. The protein was subjected to gel filtration chromatography, and elution was monitored at two different wavelengths, 280 and 410 nm (Fig. 6B), to detect the protein and the iron-sulfur clusters, respectively. The isolated protein eluted as a single monodisperse symmetric peak that was devoid of aggregates. The elution profiles recorded at 280 and 410 nm coincided, suggesting that the recombinant SSO0287 protein contained correctly assembled iron-sulfur clusters.

• Open in new tab
• Download powerpoint

FIG. 6.

Purification and gel filtration of SSO0287. (A) Coomassie blue-stained SDS-PAGE gel of Strep tag-specific affinity chromatography fractions of the cytoplasm of SSO0287 transformants. St, starting material; FT, flowthrough; E, elution fraction. (B) Gel filtration of purified SSO0287. Traces were recorded at 280 nm (black line) and 410 nm (dashed line).

The expression of SSO0287 in S. solfataricus was scaled up from 400-ml cultures to fermentation in 45 liters. A fermentor containing medium with 0.1% tryptone and 0.2% arabinose was inoculated with 1.6 liters of SSO0287-expressing S. solfataricus culture. After 2 days of growth, the cells were collected at an OD₆₀₀ of ∼0.8, and the protein was purified. The yields per liter (0.75 to 1 mg) were comparable to those from small cultures, but when the cells were grown to higher densities (ODs of about 1.5), degradation products of the purified protein were observed.