Multilocus Sequence Typing Supports the Hypothesis that Cow- and Human-Associated Salmonella Isolates Represent Distinct and Overlapping Populations

S. D. Alcaine; Y. Soyer; L. D. Warnick; W.-L. Su; S. Sukhnanand; J. Richards; E. D. Fortes; P. McDonough; T. P. Root; N. B. Dumas; Y. Gröhn; M. Wiedmann

doi:10.1128/AEM.01174-06

DOI: 10.1128/AEM.01174-06

Article Figures & Data

Figures

Tables
Additional Files

Open in new tab
Download powerpoint
FIG. 1.
Map of New York and Vermont counties where Salmonella isolates were obtained. The map was drawn using MapViewer 4.01 (Golden Sofware, Inc., Golden, CO). County codes are as follows: Alb, Albany; Brx, Bronx; Brm, Broome; Cat, Cattaraugus; Cay, Cayuga; Cha, Chautauqua; Cmg, Chemung; Cno, Chenango; Cvt, Chittenden, VT; Cli, Clinton; Cor, Cortland; Del, Delaware; Dut, Dutchess; Eri, Erie; Fra, Franklin; Fvt, Franklin, VT; Gen, Genesee; Kin, Kings; Lvt, Lamoille, VT; Lew, Lewis; Liv, Livingston; Mon, Monroe; Nas, Nassau; New, New York; Nia, Niagara; One, Oneida; Ono, Onondaga; Ont, Ontario; Ora, Orange; Orl, Orleans; Osw, Oswego; Ots, Otsego; Put, Putnam; Ren, Rensselaer; Sar, Saratoga; Sch, Schenectady; Sen, Seneca; Stl, St. Lawrence; Ste, Steuben; Suf, Suffolk; Tom, Tompkins; Uls, Ulster; Unk, Unkown; War, Warren; Was, Washington; Way, Wayne; Wes, Westchester; and Wyo, Wyoming.
Open in new tab
Download powerpoint
FIG. 2.
Phylogenetic trees based on Salmonella fimA (A) and mdh (B) gene sequences. Neighbor-joining trees were built in PAUP* using one representative isolate for each sequence type, including STs previously described by Sukhnanand et al. (49), which were not represented among the isolates found here (these STs are indicated by a *). ML trees (not shown) displayed similar clusterings and topologies. Bootstrap analyses were performed using 5,000 replications, and bootstrap values >50 are indicated. M indicates STs representing isolates that contain a manB gene duplication; the branch labeled as “clade 1” represents a number of related STs, including STs (ST52 to ST57, ST63, and ST67 in the mdh tree) that correspond to isolates with two manB copies, indicating a common ancestral event that was responsible for the two manB copies found in these isolates. D1, D2, and D3 indicate STs representing isolates that contain fimA deletion types D1 through D3 (Table 6). STs representing the two distinct Salmonella serotype Newport groups (designated types A and B) are marked by circles or boxes and the respective type.

TABLE 1.

Farms with multiple sample submission dates resulting in the isolation of Salmonella from clinically infected cattle

Farm	No. of farm sample dates with positive Salmonella samples	Subtype(s) isolated^a (no. of isolates)
510	20	ST11/serotype Newport (20), ST6/serotype 4,5,12:i:- (1)
261	22	ST6/serotype 4,5,12:i:- (18), ST17/serotype Kentucky (5), ST6/serotype Typhimurium (1)
223	15	ST60/serotype Infantis (15)
329	5	ST9/serotype Montevideo (1), ST44/serotype Muenster (3), ST62/serotype Thompson (1)
186	4	ST75/serotype Adelaide (1), ST8/serotype Typhimurium (2), ST8/serotype Typhimurium var. Copenhagen (1)
524	5	ST6/serotype 4,5,12:i:- (1), ST11/serotype Newport (4)
152	4	ST11/serotype Newport (4)
490	4	ST11/serotype Newport (4)
163	3	ST60/serotype Infantis (1), ST11/serotype Newport (2)
259	3	ST44/serotype Muenster (3)
488	3	ST11/serotype Bardo (1), ST11/serotype Newport (3)
584	3	ST2/serotype Agona (2), ST6/serotype Typhimurium (1)
97	2	ST8/serotype Typhimurium var. Copenhagen (2)
105	2	ST11/serotype Newport (1), ST8/serotype Typhimurium (1)
125	2	ST6/serotype Typhimurium (2)
208	2	ST6/serotype Typhimurium (2)
303	2	ST11/serotype Newport (2)
320	2	ST11/serotype Newport (2)
415	2	ST9/serotype Montevideo (1); ST6/serotype Typhimurium (1)
764	2	ST6/serotype Typhimurium (2)

↵ a Subtype is represented as ST/serotype.

TABLE 2.

Distribution of Salmonella serotypes among STs and human and bovine isolates

Serotype^a	ST(s)	No. of isolates from:
Serotype^a	ST(s)	Humans	Dairy cattle^b
Serotype 4,5,12:i:-	6, 40	12	3
Serotype Agona	1, 2	3	4
Serotype Enteritidis***	14, 36	26	0
Serotype Heidelberg*	3, 26, 50	10	0
Serotype Mbandaka	64, 65, 73	4	1
Serotype Montevideo	9, 56, 57, 67	4	3
Serotype Muenster*	44	1	5
Serotype Newport***	11, 13, 33, 46, 76, 78	18	25
Serotype Saint Paul	38, 81	5	0
Serotype Thompson	43, 62	5	3
Serotype Typhimurium	6, 7, 8, 47, 49	30	19
Serotype Urbana	52	5	0

↵ a Only serotypes that occurred more than five times are listed separately (for animal isolates, only one isolate with a given serotype and ST per farm was counted). Additional serotypes that occurred less than five times are as follows (numbers of human and unique bovine isolates per farm are included in parentheses): serotype 4,12:i:- (one bovine isolate), serotype Abony (two human isolates), serotype Adelaide (one human isolate and one bovine isolate), serotype Agbeni (one human isolate), serotype Anatum (three human isolates), serotype Arechavaleta (one human isolate), serotype 4,12:r:- (two human isolates), serotype Bardo (two bovine isolates), serotype Berta (two human isolates), serotype Blockley (one human isolate), serotype Braenderup (one human isolate), serotype 1,7:-:1,5 (three human isolates), serotype Cubana (one human isolate), serotype Dublin (two human isolates), serotype Give (one human isolate), serotype Hadar (two human isolates), serotype Hartford (one human isolate), serotype Havana (one bovine isolate), serotype Infantis (two human and two bovine isolates), serotype Javiana (four human isolates), serotype Kentucky (two bovine isolates), serotype Kintambo (one human isolate), serotype Litchfield (one human isolate), serotype Muenchen (three human isolates), serotype Nyanza (one human isolate), serotype Oranienburg (one human isolate and one bovine isolate), serotype Panama (three human isolates), serotype Paratyphi B (one human isolate), serotype Paratyphi B var. Java (two human isolates), serotype Paratyphi C (one human isolate), serotype Pomona (one human isolate), serotype Poona (two human isolates), serotype Rough o:i:1,2 (one bovine isolate), serotype Rublislaw (one human isolate), serotype Schwarzengrund (three human isolates), serotype Senftenberg (one human isolate), serotype Stanley (two human isolates), serotype Typhimurium var. Copenhagen (four bovine isolates), serotype Weltvreden (one human isolate), and serotype Worthington (one human isolate). Serotypes that differ significantly in frequency among human and animal isolates, as determined by chi-square test or Fisher's exact test, are marked with * (P < 0.05) or *** (P < 0.001).
↵ b Only one isolate representing each unique serotype/ST combination found on a given farm was counted; these numbers were used to avoid the overrepresentation of a subtype due to resampling on a given farm (e.g., when isolates with the same serotype/ST combination were isolated on different dates on the same farm) (Table 1).

TABLE 3.

Distribution of Salmonella STs among human and bovine isolates and among different counties in New York state

ST^a	Serotype(s)	No. of isolates from:		County origin of isolates (no. of isolates) from^c:
ST^a	Serotype(s)	Humans	Cattle^b	Humans	Dairy cattle^b
3*	Serotype Heidelberg, serotype 4,12:r:-	10	0	Dut (1), Eri (1), Fra (1), Mon (1), Nas (2), New (1), One (1), Suf (2)	None
6	Serotype Typhimurium, serotype 4,12:i:-, serotype 4,5,12:i:-	38	20	Alb (1), Brx (1), Cha (1), Cmg (1), Cor (1), Dut (1), Eri (3), Fra (1), Kin (1), Mon (1), Nas (4), Ono (2), Ora (1), Ots (1), Stl (1), Ste (2), Suf (7), Tom (1), War (1), Was (2), Wes (4)	Cat (1), Cli (3), Cor (1), Gen (1), Nia (1), Ont (1), Orl (1), Ren (3), Stl (1), Tom (1), Was (1), Wyo (5)
8***	Serotype Typhimurium, serotype Rough o:i:1,2, serotype Typhimurium var. Copenhagen	0	7	None	Cay (1), Cno (1), Osw (2), Was (3)
11***	Serotype Newport, serotype Bardo	9	27	Cno (1), Nia (1), Put (1), Sar (1), Suf (1), Uls (1), Unk (1), Way (1), Wes (1)	Cay (1), Cno (1), Cvt (2), Cli (2), Cor (1), Eri (1), Fvt (6), Gen (1), Lvt (1), Lew (1), Nia (3), One (2), Ono (1), Sen (1), Stl (1), Wyo (2)
14**	Serotype Enteritidis	19	0	Brm (1), Dut (1), Eri (3), Kin (1), Mon (2), Nas (3), Ono (2), Ora (1), Suf (2), Unk (1), Wes (2)	None
36	Serotype Enteritidis	7	0	Alb (1), Del (1), Eri (1), Mon (1), Nas (1), Tom (1), Wes (1)	None
44**	Serotype Muenster	1	5	Cmg (1)	Fra (1), Liv (1), Orl (1), Wyo (2)
52	Serotype Urbana	5	0	Cli (2), Sch (3)	None
62	Serotype Thompson	4	2	Nas (1), Sar (1), Uls (1), Way (1)	Liv (1), Nia (1)
Rare**	Various serotypes	86	17	NS	NS

↵ a Only STs that occurred five or more times are listed separately; the STs with fewer than five isolates were grouped into a category termed “rare”; STs that differ significantly in frequency among human and bovine isolates, as determined by chi-square test or Fisher's exact test, are marked with * (P < 0.05), ** (P < 0.01), or *** (P < 0.001).
↵ b Only one isolate representing each unique serotype/ST combination found on a given farm was counted; these numbers were used to avoid the overrepresentation of a subtype due to resampling on a given farm (e.g., when isolates with the same serotype/ST combination were isolated on different dates on the same farm) (Table 1).
↵ c Counties are depicted in Fig. 1. County codes are as follows: Alb, Albany; Brx, Bronx; Brm, Broome; Cat, Cattaraugus; Cay, Cayuga; Cha, Chautauqua; Cmg, Chemung; Cno, Chenango; Cvt, Chittenden, VT; Cli, Clinton; Cor, Cortland; Del, Delaware; Dut, Dutchess; Eri, Erie; Fra, Franklin; Fvt, Franklin, VT; Gen, Genesee; Kin, Kings; Lvt, Lamoille, VT; Lew, Lewis; Liv, Livingston; Mon, Monroe; Nas, Nassau; New, New York; Nia, Niagara; One, Oneida; Ono, Onondaga; Ont, Ontario; Ora, Orange; Orl, Orleans; Osw, Oswego; Ots, Otsego; Put, Putnam; Ren, Rensselaer, Sar, Saratoga; Sch, Schenectady; Sen, Seneca; Stl, St. Lawrence; Ste, Steuben; Suf, Suffolk; Tom, Tompkins; Uls, Ulster; Unk, Unkown; War, Warren; Was, Washington; Way, Wayne; Wes, Westchester; Wyo, Wyoming. NS, not shown.

TABLE 4.

Serotypes that include at least one isolate that carries two manB copies^a

Serotype	ST(s) of human isolates (no of isolates) within a given serotype that carry:		ST(s) of cattle isolates (no. of isolates) within a given serotype that carry^b:
Serotype	Two manB copies	One manB copy	Two manB copies	One manB copy
Serotype Agbeni	63 (1)	None	None	None
Serotype Braenderup	61 (1)	None	None	None
Serotype 1,7:-:1,5	58 (1)	42 (1), 43 (1)	None	None
Serotype Cubana	71 (1)	None	None	None
Serotype Havana	None	None	69 (1)	None
Serotype Infantis	60 (2)	None	60 (1)	None
Serotype Kintambo	59 (1)	None	None	None
Serotype Mbandaka	64 (2)	73 (2)	65 (1)	None
Serotype Montevideo	56 (2), 57 (1), 67 (1)	None	None	9 (3)
Serotype Nyanza	66 (1)	None	None	None
Serotype Oranienburg	53 (1)	None	53 (1)	None
Serotype Poona	55 (1)	28 (1)	None	None
Serotype Rublislaw	54 (1)	None	None	None
Serotype Thompson	62 (4)	43 (1)	62 (2)	43 (1)
Serotype Urbana	52 (5)	None	None	None
Serotype Worthington	68 (1)	None	None	None

↵ a Serotypes for which all isolates carry only a single manB copy are not included in this table.
↵ b Only one isolate representing each unique serotype/ST combination found on a given farm was counted; these numbers were used to avoid the overrepresentation of a subtype due to resampling on a given farm (e.g., when isolates with the same serotype/ST combination were isolated on different dates on the same farm) (Table 1).

TABLE 5.

Serotypes that include at least one isolate that carries a deletion in the 3′ end of fimA^a

Serotype	fimA deletion type	ST(s) of human isolates (no. of isolates) within a given serotype that carry:		ST of cattle isolates (no. of isolates^b) within a given serotype that carry:
Serotype	fimA deletion type	fimA deletion	No fimA deletion	fimA deletion	No fimA deletion
Serotype Newport	D1	78 (3)	11 (9), 13 (1), 33 (2), 46 (2), 76 (1)	None	11 (25)
Serotype Weltvreden	D2	79 (1)	None	None	None
Serotype Paratyphi C	D2	80 (1)	None	None	None
Serotype Saint Paul	D3	81 (1)	38 (4)	None	None
Serotype Berta	D3	82 (1), 83 (1)	None	None	None
Serotype Stanley	D3	84 (1)	39 (1)	None	None

↵ a Serotypes for which all isolates carry no deletion in the 3′ end of fimA are not included in this table.
↵ b Only one isolate representing each unique serotype/ST combination found on a given farm was counted; these numbers were used to avoid the overrepresentation of a subtype due to resampling on a given farm (e.g., when isolates with the same serotype/ST combination were isolated on different dates on the same farm) (Table 1).

TABLE 6.

DNA and amino acid sequences of fimA deletion types D1, D2, and D3^a

Deletion type	DNA sequence	Amino acid sequence
Wild type	GCACGCTATAAGGCAACCGCCGCCGCCACGACGCCAGGCCAGGCTAAT	ARYKATAAATTPGQANADATFIMKYE
D1	GCACGCTATAAGGCAACCGCCGCCGCCGCGACGCCAGGC-----TAAT	ARYKATAAAATPG
D2	GCACGCTATAAGGCAACCGCCGCC---ACGACGCCAGGCCAGGCTAAT	ARYKATAA-TTPGQANADATFIMKYE
D3	GCACGCTATAAGGCAACCGCCGCCGCG---ACGCCAGGCCAGGCTAAT	ARYKATAAA-TPGQANADATFIMKYE

↵ a Nucleotide sequences surrounding the deletions in the 3′ region of fimA and amino acid sequences surrounding the deletions in the 3′ region of fimA are shown. The first amino acid corresponds to the first codon shown in the DNA sequence. Whereas the amino sequence includes the stop codon, the nucleotide sequence shown is missing the nucleotides encoding the last 10 amino acids.

Additional Files

Figures
Tables

Supplemental material

Files in this Data Supplement:

Supplemental file 1 - Table S1 (Salmonella isolates included in the study)
Zipped PDF document, 18K.