Article Figures & Data
Figures
- FIG. 1.
Streptococcus salivarius K12 (even-numbered lanes) and S. pyogenes SF370 (odd-numbered lanes) amplification products resulting from PCR using specific primers for the sagA (lanes 2 and 3), scpA (lanes 5 and 6), smez-2 (lanes 8 and 9), speB (lanes 11 and 12), and emm (lanes 14 and 15) genes. Lanes 1 and 17, 1-kb marker (Gibco).
- FIG. 2.
Autoradiographs of Southern blots hybridized with amplicons of the different streptococcal virulence factors (given at the bottom). Lanes containing HindIII-digested DNA from S. pyogenes SF370 are labeled SF370. Lanes containing HindIII-digested DNA from S. salivarius strain K12 are labeled K12.
Tables
- TABLE 1.
Antibiotic disk sensitivities of S. salivarius isolates
Antibiotic (concn [μg]) Inhibition zone size (mm) for: Strain K12 lineage HD ToveR #6 K30 HA HB HC K26R K12- J89a K12- Labb K12- BN21c Penicillin (10) 34 34 39 34 29 26 26 26 27 27 28 Amoxicillin (10) 35 32 35 35 28 26 29 26 26 28 27 Ofloxacin (5) 18d 18d 15d 18d 19d 17d 16d 16d 18d 16d 18d Tetracycline (30) 28 27 26 28 27 27 22 27 28 28 27 Erythromycin (15) 30 30 31 30 28 29 26 28 29 27 27 Gentamicin (10) 15d 14d 14d 15d 15d 16d 14d 12d 12d 12d 14d Clindamycin (2) 29 26 28 29 28 26 26 29 30 28 25 - TABLE 2.
API 20 Strep and API 50CH positive reactions for Streptococcus salivarius K12 cultures
Test Reaction of: K12-J89a K12-Labb K12-BN21c API 20 Strepd Acetoin production + + + β-Glucosidase + + + Alkaline phosphatase + + + Leucine aminopeptidase + + + d-Lactose + + + d-Trehalose + + + Inulin + + + d-Raffinose + + + API 50CH d-Galactose + + + d-Glucose + + + d-Fructose + + + d-Mannose + + + N-Acetylglucosamine + + + Arbutine + + + Salicin + + + d-Cellobiose + + + d-Maltose + + + d-Lactose + + + d-Saccharose + + + d-Trehalose + + + Inulin + + + d-Raffinose + + + d-Tagatose + + + - TABLE 3.
Primers used to amplify streptococcal virulence genes
Virulence determinant Gene designation Primer name Primer sequence (5′-3′) Amplicon size (bp) Reference Streptolysin S sagA sagA Fwd ATTGAGCTAGCCTTGTCCTTGT 1,164 This study sagB Rev GTATTCCGCAAAATCTCTAACG C5a peptidase scpA scpA Fwd CGGGTATCATGGGACTGTTGC 1,259 This study scpA Rev TTGCCGATGTTGCGACTTC SMEZ-2 smez-2 smez-2 Fwd GGACGAATATGCAGCCAATGA 332 This study smez-2 Rev GTATGAAAAACCAGTCTACCAC SPE-B speB speB Fwd TGACGCTAACGGTAAAGAAAACA 819 This study speB Rev GCCGCCACCAGTACCAAGAGC M-protein emm M-all Fwd TATTSGCTTAGAAAATTAA 961 13 M-all Rev GCAAGTTCTTCAGCTTGTTT - TABLE 4.
Counts of facultatively anaerobic bacteria and S. salivarius in saliva of individuals prior to and in the days following dosing with S. salivarius K12a
Organism(s) Mean CFU/ml (SD) at the following time of sampling: Maximum CFU/ml detected in any single sample Predosing Day 3 Day 7 Day 14 Day 28 Facultatively anaerobic bacteria 3.11e7 (2.4e7) 3.09e7 (2.1e7) 3.98e7 (2.3e7) 3.93e7 (2.9e7) 3.32e7 (2.1e7) 1.1e8 S. salivarius 1.54e7 (2.4e7) 7.80e6 (1.3e7) 1.33e7 (1.1e7) 6.58e6 (5.9e6) 7.2e6 (7.1e6) 7.7e7 ↵ a Subjects included 4 males and 10 females; mean age, 19 years. P values for time point differences for counts of facultatively anaerobic bacteria and S. salivarius were not significant (>0.5 by nonparametric analysis of variance).
- TABLE 5.
Detection of specific microorganisms in saliva of individuals prior to and in the days following dosing with Streptococcus salivarius K12a
Organism(s) No. of subjects in which the indicated class of microbe was detected/total no. of subjects at the following sampling time: Maximum CFU/ml detected in any single sample Predosing Day 3 Day 7 Day 14 Day 28 S. salivarius K12-like BLISc profile 2/14 13/14 12/14 9/14 4/14 NAd S. salivarius K12-like BLIS profile >50% 2/14 7/14 7/14 3/14 1/14 NA S. mutans b 9/14 11/14 9/14 11/14 9/13 6.3e5 S. mutans >1e4 CFU/ml 4/14 4/14 4/14 5/14 4/14 NA S. mutans >1e5 CFU/ml 2/14 2/14 1/14 1/14 1/14 NA Lactobacilli 6/14 5/14 4/14 7/14 2/14 2.8e5 Candida 1/14 NDe 1/14 1/14 1/14 4.4e4 Coliforms 1/14 2/14 0/14 1/14 0/14 140 Pseudomonas 11/14 8/14 10/14 9/14 5/14 100 Staphylococcus aureus 3/14 4/14 1/14 2/14 2/14 1,000
