Genotypic Diversity of Haemophilus parasuis Field Strains

Bacterial strains and culture conditions.A total of 103 strains, including 13 H. parasuis reference strains, were used in this study (Table 1). Field strains included clinical isolates, both systemic and respiratory, and nasal isolates from healthy piglets from farms without Glässer's disease. To obtain the nasal isolates, four farms in two separate regions of Spain were selected based on their health status. Eight to 10 nasal swabs were taken from each farm and transported in Amies medium to the laboratory, where they were plated on chocolate agar to isolate colonies. After 2 to 3 days at 37°C with 5% CO₂, suspected colonies were selected and subcultured for further analysis. In addition to classical biochemical tests, final identification was performed by 16S rRNA gene sequencing (see below). Clinical isolates were kindly provided by the Department of Infectious Diseases of the Veterinary School of the Universitat Autònoma de Barcelona (Spain), by E. Rodríguez Ferri (Universidad de León, Spain), by Gustavo C. Zielinski (Instituto Nacional de Tecnología Agropecuaria-INTA, Argentina), and by T. Blaha (Federal Institute for Health Protection of Consumers and Veterinary Medicine, Germany). Strains of the closely related species A. minor, A. indolicus, A. porcinus, Actinobacillus pleuropneumoniae, and Pasteurella multocida were also included in the study. All of the strains were maintained in 20% glycerol-brain heart infusion broth at− 80°C and routinely cultured in chocolate agar plates at 37°C with 5% CO₂.

DNA extraction, PCRs, and sequencing.For each strain, a bacterial suspension was made in sterile phosphate-buffered saline and used to extract genomic DNA with a Nucleospin blood kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany) following the manufacturer's instructions.

For identification purposes, the 16S rRNA gene was amplified and sequenced. 16S rRNA gene amplification was carried out using 3 mM MgCl₂, a 0.2 mM concentration of each deoxynucleoside triphosphate, 5 μl of extracted DNA, 0.5μ M forward primer (16S-up [5′ AGAGTTTGATCATGGCTCAGA 3′]), 0.5 μM reverse primer (16S-dn [5′ AGTCATGAATCATACCGTGGTA 3′]), and 1.5 U EcoTaq polymerase (Ecogen, Madrid, Spain) in a 50-μl reaction mix.

The hsp60 amplicon was obtained with universal degenerate primers for hsp60 by following a previously published protocol (18), with some modifications. The standard PCR mixture for hsp60 contained 1.5 mM MgCl₂, a 0.2 mM concentration of each deoxynucleoside triphosphate, a 0.5 μM concentration of each universal primer, 1.5 U EcoTaq polymerase (Ecogen, Madrid, Spain), and 5 μl of extracted DNA in a 50-μl reaction volume. Amplification was performed for 35 cycles with an annealing temperature of 50°C.

The hsp60 and 16S rRNA gene amplicons were sequenced using a BigDye Terminator v.3.1 kit and an ABI 3100 DNA sequencer (Applied Biosystems, Foster City, Calif.) with the same PCR primers and additional internal primers for the 16S rRNA gene (16SI1 [5′ TTGACGTTAGTCACAGAAG 3′], 16SI2 [5′ TTCGGTATTCCTCCACATC 3′], 16SI3 [5′ TAACGTGATAAATCGACCG 3′], and 16SI4 [5′ TTCACAACACGAGCTGAC 3′]). For identification purposes, sequence database searches were performed using programs based on the BLAST algorithm (1). Both the NCBI (http://www.ncbi.nlm.nih.gov/BLAST ) and Ribosomal Database Project (http://rdp.cme.msu.edu ) databases were searched.

For ERIC-PCR, purified DNA was quantified by spectrometry, and 100 ng was used as a template. The technique was performed by following a previously published protocol (35), including an extra final extension step of 20 min. Aliquots of 5 μl of PCR product were analyzed by electrophoresis (70 V, 3 h) in a 2% agarose gel. Band patterns were visualized by staining with a 1:10,000 dilution of SYBR gold (Invitrogen S.A., Barcelona, Spain) in 50 mM Tris and 5 mM EDTA buffer (pH 7.4) for 30 min. For normalization purposes, outer lanes contained a Superladder-Mid1 dsDNA marker kit (Eurogentec, Liege, Belgium). Images of the gel were captured with a Bio-Rad (Barcelona, Spain) transilluminator and stored as TIFF files for further analysis. Bands of 100 to 4,000 bp were used in the analysis.

Data analysis.ERIC-PCR fingerprint analysis, sequence editing and analysis, and similarity matrix calculations were carried out using Fingerprinting II v3.0 software (Bio-Rad). Phylogenetic studies were carried out using the MEGA2 program (27).

ERIC-PCR band patterns were normalized, and Pearson correlation similarity matrixes were calculated. Cluster analysis of ERIC-PCR fingerprints was performed by the unweighted-pair group method using average linkages (UPGMA) as previously recommended (37). Maximum parsimony and neighbor-joining (using the Kimura two-parameter model) consensus trees for hsp60 and 16S rRNA gene partial sequences were constructed with 1,000 bootstrap values, and branches supported by bootstrap values of <50% were collapsed (5, 20).

16S rRNA gene sequencing.Partial 16S rRNA gene sequences of 1,391 to 1,394 nucleotides in length were obtained for each of the H. parasuis and Actinobacillus strains (GenBank accession numbers DQ228974 to DQ229076 ). The sequences were aligned with nucleotides 50 to 1448 of the Escherichia coli K-12 16S rRNA gene sequence (rrsH; GenBank accession number NC000913 ). Six insertion-deletion differences were identified. The aligned sequences showed 251 variable positions out of 1,397 total positions (18%). A pairwise alignment similarity matrix was constructed. The pairwise similarities among the H. parasuis strains ranged from 95.04 to 100%. By taking every different sequence, even if just one nucleotide was different, as a sequence type (ST), 30 different STs were defined for H. parasuis (indicated by consecutive letters A to Z and AA to AF) (Table 1). Interestingly, STs I, J, and Q were associated with clinical isolates, while STs F, K, and M were only found in nasal isolates. Notably, ST H was represented in three virulent reference strains. Maximum parsimony and neighbor-joining analyses were congruent, and the neighbor-joining tree is shown in Fig. 1. This analysis showed a monophyletic cluster containing all of the H. parasuis strains supported by a bootstrap value of 65%. Within the H. parasuis cluster, several subclusters were detected. Cluster A (Fig. 1) was supported by a high bootstrap value (99%) and contained virulent reference strains H367, Nagasaki, 84-22113, and 84-15995, together with clinical isolates (mainly systemic) and just one strain isolated from the nose (CA38-4). It is noteworthy that strain CA38-4 was isolated from a farm with an outbreak of Glässer's disease. Three subclusters showed bootstrap values of 95% or higher, but they were composed of very closely related isolates which were mainly collected from the same farm (clusters B, C, and D) (Fig. 1). Clusters C and D included strains isolated from diseased animals (112/02 and RW), while cluster B was composed of nasal isolates. Finally, a main cluster (cluster E) (Fig. 1) contained the rest of the clinical and nasal isolates and reference strains 4, D74, 174, C5, H465, and SW114.

hsp60 sequencing.Once the strains were classified to the species level, we next tested the value of the hsp60 sequence in genotyping H. parasuis isolates. Thus, partial sequences of 596 nucleotides were obtained from the 103 strains tested (GenBank accession numbers DQ198861 to DQ198950 and DQ228961 to DQ228973 ). The sequences were aligned with nucleotides 254 to 849 of the groEL gene of E. coli K-12 (GenBank accession number NC000913 ). All the sequences were aligned without gaps, and 228 of 596 (38%) positions were variable, with pairwise similarities ranging from 93.63 to 100%. For the H. parasuis isolates, 36 different STs were identified (indicated by consecutive numbers 1 to 36) (Table 1). Importantly, STs 3, 8, 9, 12, and 13 were associated with clinical isolates, while STs 2, 17, and 19 were only found in nasal isolates. Further examination of the sequences showed that variation was primarily limited to the third codon position (only 24% of amino acid positions were variable), and the average ratio of nonsynonymous to synonymous substitutions (ω) was 0.05. Figure 2 shows the neighbor-joining consensus tree for the sequences. Congruence, calculated as the Pearson product-moment correlation coefficient, between the 16S rRNA gene and hsp60 neighbor-joining trees was 75%. hsp60 sequences grouped all H. parasuis strains in one monophyletic cluster supported by a 99% bootstrap value. Unexpectedly, the following three strains previously classified as Actinobacillus by 16S rRNA gene sequencing were also included in the H. parasuis cluster: A. indolicus reference strain 37E3 and A. minor isolates 49 and 2134 (Fig. 1 and 2). Cluster 1 (Fig. 2) included field isolates, mainly clinical isolates, and virulent reference strains SW140, Nagasaki, 84-15995, and H367. Cluster 2 (Fig. 2) was structured in seven internal branches and included the majority of field isolates and reference strains 84-22311, SW124, C5, H465, D74, 174, 4, and SW114. The second cluster also contained isolate A. minor 49.

An examination of the hsp60 sequences from Actinobacillus strains available at the NCBI database showed the presence of putative DNA-uptake signal sequences (USS). In the hsp60 gene from A. pleuropneumoniae (accession number U55016 ), two sequences (AAGTGGCGT at position 226 and AAGTGGCGA at position 1146) very similar to the USS of Haemophilus influenzae (AAGTGCGGT) (4) could be detected. Also, in the Actinobacillus ureae hsp60 partial sequence (accession number AY123720 ), the sequence AAGTGGCTG was detected. For the H. parasuis and Actinobacillus sequences obtained in this study, the sequence AAGTGGCT/AG was present at position 562 of the amplicons. The presence of these putative USS, together with the different topologies of the 16S rRNA gene and hsp60 trees, supports the occurrence of lateral transfer of the hsp60 gene among the Actinobacillus and Haemophilus strains.

ERIC-PCR fingerprints.We further compared our data with the previously described ERIC-PCR method for H. parasuis. ERIC-PCR patterns for H. parasuis isolates were highly heterogeneous, and sometimes no common band between different fingerprints could be found. After curve-based Pearson correlation similarity matrix calculation, ERIC-PCR fingerprints led to similarities ranging from 0 to 99.07%. ERIC-PCR fingerprints were more variable and led to less similarity than both hsp60 and 16S rRNA gene sequences. After the UPGMA tree was built, 10 different clusters were defined (I to X) (Fig. 3). Cluster I contained nasal isolates from three different farms in Spain and reference strain 4. Cluster II contained nasal and lung isolates and five reference strains (C5, D74, SW114, SW140, and 84-15995). Clusters III, IV, and V contained isolates from different origins (Spain, Germany, United Kingdom, and Argentina) and several isolates from diseased animals. Reference strain H367 was included in cluster III, and strain 174 was included in cluster V. Notably, cluster VI was formed mainly by virulent reference strains Nagasaki, 84-22113, and SW124 and by isolates from diseased animals. Only the nonvirulent reference strain H465 and nasal isolate IQ8N-6 were also included in cluster VI. Cluster VII was formed by four clinical isolates from Spain, the United Kingdom, and Argentina. Clusters IX and X were mainly nasal isolates from the same farm.