Article Figures & Data
Figures
- FIG. 1.
Representative PCR amplification profile obtained from the fourplex real-time PCR analysis of products amplified from serially diluted heat-lysed V. cholerae AI-1838. All four targets—rtxA (A), epsM (B), ompW (C), and tcpA (D)—were detected simultaneously by the four different molecular beacons. To determine the limit of detection of the assay, the dilutions contained the following CFU of V. cholerae: 1 × 105 (▪), 1 × 104 (•), 1 × 103 (▴), 1 × 102 (▸), 10 (⧫), 5 (□), and 1 (○). ▵, negative control. The optimized multiplex PCR amplification profile consisted of 150 s at 95°C, followed by 45 cycles of three steps consisting of 30 s at 95°C, 60 s at 60°C, and 30 s at 72°C using the Smart Cycler (Cepheid, Sunnyvale, Calif.). Fluorescence signals emitted from the molecular beacon were measured at the end of each annealing step. Each analysis was repeated multiple times to ensure the reproducibility of results.
Tables
- TABLE 1.
Bacterial strains assayed by molecular-beacon real-time PCR
Serogroup and strain Sourcea (origin) Detectionb of the indicated gene by: Single PCR (1 × 103 CFU) Multiplex PCR (1 × 105 to 5 CFU)c rtxA epsM ompW tcpA rtxA epsM ompW tcpA V. cholerae O1 classical 11966 A (Bangladesh, 1987) + + + − + + + − AA14041 A (Bangladesh, 1985) + + + − + + + − Z17561 A (Bangladesh, 1985) + + + − + + + − Z17561 tcpA::kan (tcpA mutant) A (University of Adelaide) + + + − + + + − 0162 C (India) + + + − 162 C (India) + + + − 569B C (Unknown) + + + − 569B-685RNM C (Unknown) + + + − 35A3 C (Unknown) + + + − 111-V585R C (Unknown) + + + − 95 C (India) + + + − V. cholerae El Tor N16961 A (Unknown) + + + + + + + + AA13993 A (Bangladesh, 1985) + + + + + + + + H1 A (India, 1985) + + + + + + + + H1 tcpA::kan (tcpA mutant) A (University of Adelaide) + + + − + + + − HP-51-1 C (Thailand, 1972) + + + + BRL 7738 C (1966) + + + + N107 C (Unknown) + + + + VB1961 C (Unknown) + + + + I-816 C (Unknown) + + + + V. cholerae O139 AI-1838 A (Bangladesh, 1993) + + + + + + + + AI-1854 A (Bangladesh, 1993) + + + + + + + + AI-1855 A (Bangladesh, 1993) + + + + + + + + V. cholerae non-O1 V. cholerae non-O1 B (Fairfield Hospital, Australia) + + + − H II (nonagglutinating)d C (Hong Kong, 1963) + + + − Other Vibrio spp. V. anguillarum ATCC 19246e ATCC − − − − V. alginolyticus B (MDU, Australia) − − − − V. alginolyticus ATCC 17749 ATCC − − − − V. campbellii ATCC 25920e ATCC − − − − V. fischerie B (Microtox kit strain 2000) − − − − V. fluvialis A (Unknown) − − − − V. harveyi 179e (tentative name) C (Unknown) − − − − V. mimicus A (Unknown) +/− − − +/− − V. mimicus B (Fairfield Hospital, Australia) +/− − − +/− − V. natriegens NCMB 857f NCMB − − − − V. pagrus MIC-2e C (Pagrus auratus) − − − − V. parahaemolyticus ATCC 17802 ATCC − − − − V. parahaemolyticus NCTC10884 NCTC − − − − V. parahaemolyticus NCTC10885 NCTC − − − − V. vulnificus B (RCPA, QAP 1995:8:4) − − − − V. vulnificus C7184 CDC − − − − V. vulnificus C7184T CDC − − − − Other bacteria Bacillus subtilis ATCC 6051f ATCC − − − − Enterococcus faecalis 159905660 Pathcentre, Perth, Australia − − − − Escherichia coli PA03M55679 Pathcentre, Perth, Australia − − − − Klebsiella pneumoniae 106156559 Pathcentre, Perth, Australia − − − − Pseudomonas aeruginosa PA03M2615 Pathcentre, Perth, Australia − − − − Serratia marcescens 13023f Pathcentre, Perth, Australia − − − − Shigella sonnei ATCC 9290 ATCC − − − − Staphylococcus aureus ATCC 9144 ATCC − − − − Yersinia enterocolitica W22703 Melbourne University − − − − ↵ a A, Stephen Attridge, University of Adelaide; B, Celia McKenzie, Royal Melbourne Institute of Technology; C, University of New South Wales; MDU, Microbiological Diagnostics Unit; RCPA, Royal College of Pathologists of Australasia Quality Assurance Program.
↵ b Blank, not tested; +, specific amplified product detected; −, no amplified product detected; +/−, limited product detected.
↵ c All Vibrio spp. other than V. cholerae and all other bacterial species were assessed using 106 CFU.
↵ d Serotype unknown.
↵ e Grown at 25°C.
↵ f Grown at 30°C.
- TABLE 2.
Molecular beacon probes used in this study
Target gene Beacon Sequence (5′-3′)a Size (bp) Fluorophore Quencher Concnb (μM) multiplex rtxA MBrtxA CGCGATC ACCAGAGCGCCAAGAAGTGACTCGTAGATCGCG 40 FAMc Dabcyl 0.25 epsM MBepsM CGCGAT GCCACCGACATCGTAACGCTCCGATCGCG 35 Texas Red BHQ2 0.25 ompW MBompW CCGAA GAAACAACGGCAACCTACAAAGCTTCGG 33 Cy5 BHQ3 0.25 tcpA MBtcpA CGCGAC GCTGAAACCTTACCAAGGCTGACCAAGTCGCG 38 Cy3 BHQ2 0.50 ↵ a Molecular beacons were designed using Beacon Designer (version 2.12) software from Premier Biosoft (Palo Alto, CA). Underlined nucleotides indicate the stem sequence of each molecular beacon. MBrtxA, MBepsM, and MBompW were synthesized by TIB MOLBIOL (Berlin, Germany). MBtcpA was synthesized by Proligo (Helios, Singapore).
↵ b Remaining PCR constituents were 2 U of FastStart Taq DNA polymerase, 1× PCR buffer, 4 mM MgCl2, 200 μM each deoxynucleoside triphosphate (all from Roche Diagnostics, Laval, Quebec, Canada), and 2 μl of template DNA in a 25-μl final volume.
↵ c FAM, 6-carboxyfluorescein.
- TABLE 3.
Fourplex detection of V. cholerae from spiked water samples
Source Detection of V. choleraea in: Unprocessed samples (LOD, 103 CFU/reaction) Isolated DNA (LOD, 10 CFU/reaction) 11966 N16961 AI-1839 Vibriob − C 11966 N16961 AI-1839 Vibrio − C Sea (Port Phillip Bay, Melbourne, Australia) − − − +/− − + + + +/− − Estuarine (Yarra River, Melbourne, Australia) + + + +/− − + + + +/− − River (Plenty River, Victoria, Australia) + + + +/− − + + + +/− − Dam (South Morang, Victoria, Australia) + + + +/− − + + + +/− − Commercial spring water + + + +/− − + + + +/− − ↵ a LOD, limit of detection; − C, negative control (unspiked water sample); +, specific amplified product detected; −, no amplified product detected; +/−, limited product detected (ompW only).
↵ b Vibrio, a mixture of V. fluvialis, V. parahaemolyticus, V. alginolyticus, V. mimicus, and V. vulnificus at 1 × 105 CFU of each strain per PCR.
