Transfer of Conjugative Elements from Rumen and Human Firmicutes Bacteria to Roseburia inulinivorans

Transfer of the CTn Tn1545.

Tn1545, which carries the tet(M) gene, was transferable from the rumen Eubacterium cellulosolvens strain 5484 to a spontaneous rifampin-resistant mutant of R. inulinivorans A2-194 (A2-194^R), at frequencies of 10⁻⁵ transconjugants per donor cell. Anaerobic filter matings followed the method of Hespell and Whitehead (14), modified as described previously (20). Parent cells were grown anaerobically in M2GSC medium lacking antibiotics overnight to stationary phase prior to mating. Potential transconjugants grew on selective M2GSC agar plates containing rifampin (100 μg ml⁻¹) and tetracycline (10 μg ml⁻¹) for 2 days, and their resistance phenotypes were confirmed by replating selected colonies on double-antibiotic plates. Subsequent stocks of transconjugants were prepared from single colonies. The 16S rRNA gene from each transconjugant was amplified by PCR using eubacterial primers fD1 and rP2 (28), and limited sequencing of the amplicons confirmed that transconjugants were R. inulinivorans isolates.

Chromosomal DNA isolated from transconjugants was subjected to restriction enzyme digestion, separated by pulsed-field gel electrophoresis (PFGE), Southern blotted, and hybridized to a tet(M) probe as described previously (3, 20). Single insertion of Tn1545 was predicted to give one hybridizing fragment following restriction with HindIII [which cleaves 63 nucleotides into tet(M) but not within the probe sequence] and two hybridizing fragments following cleavage at the ClaI site, located at 913 nucleotides in tet(M), within the probe sequence. Six different complex hybridization profiles were observed with 12 R. inulinivorans transconjugants when the ClaI and HindIII hybridization patterns were compared (Fig. 1, lanes 2, 4, 6, 9, 11, and 12). The lower band (∼2.5 kb) present in all transconjugants is due to the presence of an additional ClaI site upstream of tet(M), within Tn1545 (Fig. 1a). Tn1545 was shown previously to insert into different sites in five E. cellulosolvens transconjugants (2) and to target AT-rich regions in the genome (15, 27).

• Open in new tab
• Download powerpoint

FIG. 1.

Southern blot of genomic DNA purified from R. inulinivorans A2-194 transconjugants containing Tn1545, digested with ClaI (a) or HindIII (b). Lanes 1 to 12, selected transconjugants; lane 13, recipient strain. The sizes of key marker bands are indicated on the left. Unique patterns are represented by transconjugants in lanes 2, 4, 6, 9, 11, and 12.

DNA sequences flanking the left end of Tn1545 were obtained for seven transconjugants with six distinct banding patterns. Chromosomal DNA was partially digested with Sau3A, and the 0.5- to 1-kb fraction was ligated into a pBluescript vector (Stratagene) and amplified with M13 specific primers in combination with primers located ∼100 bp from each end of Tn1545 based on the sequence published by Caillaud and Courvalin (6) (Tn1545left, 5′ AGCTCATTCATAAGTAGT 3′; Tn1545right, 5′ CGTGAAGTATCTTCCTACAG 3′). The resulting amplicons were purified and sequenced directly using primer Tn1545left. All seven sequences were identical up to and following the left end of Tn1545 (6), and the same sequence was also obtained for the donor E. cellulosolvens strain. The transferred DNA therefore included DNA in addition to Tn1545 that was presumably derived from E. cellulosolvens. The most plausible explanation is that Tn1545 became part of a larger conjugal transfer element upon integration into the E. cellulosolvens donor strain and that this larger element is able to insert at more than one site upon transfer to R. inulinivorans.

Transfer of the CTn TnK10.

The human gut isolate C. saccharolyticum K10 harbors the transmissible tetracycline resistance gene tet(O/32/O) and also a tet(W) gene (16, 24). Transfer of tet(O/32/O) only was detected in matings with the rumen recipient strain B. fibrisolvens 2221^R (16). tet(O/32/O) was therefore postulated to be carried on the CTn TnK10, which had a common insertion site in two transconjugants analyzed (16). Since the two bacteria capable of harboring TnK10 belong to clostridial cluster XIVa, this transposon was considered a promising candidate for further experiments on transfer to R. inulinivorans A2-194.

Transfer of tetracycline resistance occurred between C. saccharolyticum K10 and the recipient R. inulinivorans A2-194^R, at frequencies of 10⁻⁶ transconjugants per donor cell. Gene transfer was confirmed by PCR amplification of the tet(O/32/O) gene using a primer pair specific for the internal tet(32) region (18) [tet(32)for, 5′-AACCGAAGCATACCGCTC-3′; tet(32)rev, 5′-CTCTTTCATAGCCACGCC-3′]. We were unable to estimate the size of TnK10 based on PFGE analysis (data not shown). However, sequencing of homologous elements indicated that TnK10 is likely to be larger than 21 kb (EMBL database accession number AM419751; M. Rincon, personal communication). The band profile on a PFGE gel was immobilized by Southern blotting, and the blot was hybridized to a radioactively labeled tet(O/32/O) probe. The restriction enzyme SalI does not cut internally in tet(O/32/O), and a single insertion of TnK10 should result in a single hybridizing band. A 90-kb band hybridized to the tet(O/32/O) probe in all five of the transconjugants analyzed, with an additional 60-kb band present in two transconjugants (Fig. 2, lanes 3 and 5). This implies that TnK10 has a preferred insertion site in R. inulinivorans but that insertions into a second site can also occur. A much larger single band of about 200 kb hybridized in the donor genome but was absent in the transconjugants.

• Open in new tab
• Download powerpoint

FIG. 2.

Southern blot of a representative PFGE gel hybridized to the internal tet(32) sequence. R, recipient R. inulinivorans A2-194; D, donor C. saccharolyticum K10; lanes 1 to 5, representative transconjugants containing TnK10. The sizes of key bands are indicated on the right.

Conclusions.

The rumen B. fibrisolvens and E. cellulosolvens and human R. inulinivorans isolates studied here all belong to clostridial cluster XIVa (7), the single most abundant phylogenetic group of bacteria resident in both the human colon (25) and the rumen (26). Through this and previous work (21), we have shown that transfer of antibiotic resistance genes occurs in both directions between rumen and human gut representatives of this important group of gut Firmicutes. Previous evidence has shown that rumen and human gut representatives of the major gram-negative phylum, the Bacteroidetes, can also exchange resistance genes (23). Transfer of TnK10 and Tn1545 between unrelated gut anaerobes was easily detected, but repeated attempts to transfer the rumen CTn TnB1230 to R. inulinivorans A2-194 were unsuccessful. Interestingly, TnB1230 transfers at extremely high frequencies between two phylogenetically distinct strains of B. fibrisolvens (12, 20), and the lack of transfer to R. inulinivorans A2-194 presumably reflects the restricted host range of TnB1230. In fact, the donor, B. fibrisolvens 1.230, is phylogenetically more closely related to Roseburia species than to the recipient, B. fibrisolvens 2221^R (4).

Genetic manipulation of bacteria within clostridial cluster XIVa would enhance the ability to investigate the function of specific genes, and it was hoped that one of the CTns studied here would enable transposon mutagenesis in this group. TnK10 showed preferential insertion in R. inulinivorans but remains of interest as a potential delivery system, once more sequence information is available. Although Tn1545 apparently had multiple insertion sites in the R. inulinivorans genome, this was inferred to be due to its transfer as part of a larger element, whose structure and behavior require further investigation. Genomic sequencing of the donor and recipient bacteria may prove the most effective approach to clarifying the transfer mechanisms of Tn1545 and TnK10.

In conclusion, this work demonstrates conjugal gene transfer in laboratory matings with a strictly anaerobic Firmicutes bacterium from the human gastrointestinal tract as the recipient, thus hopefully providing a first step toward genetic manipulation in this important group of bacteria. These experiments emphasize the extent of gene flow between predominant groups of gut bacteria.

Nucleotide sequence accession number.

The accession number for the 16S rRNA sequence of C. saccharolyticum K10 is EU305624.