Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AEM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Applied and Environmental Microbiology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AEM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Meeting Presentations

Multiplex Fast Real-Time PCR for Quantitative Detection and Identification of cos- and pac-Type Streptococcus thermophilus Bacteriophages

Beatriz del Rio, María Cruz Martín, Noelia Martínez, Alfonso H. Magadán, Miguel A. Alvarez
Beatriz del Rio
Instituto de Productos Lácteos de Asturias (IPLA, CSIC), 33300 Villaviciosa, Asturias, Spain
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
María Cruz Martín
Instituto de Productos Lácteos de Asturias (IPLA, CSIC), 33300 Villaviciosa, Asturias, Spain
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Noelia Martínez
Instituto de Productos Lácteos de Asturias (IPLA, CSIC), 33300 Villaviciosa, Asturias, Spain
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Alfonso H. Magadán
Instituto de Productos Lácteos de Asturias (IPLA, CSIC), 33300 Villaviciosa, Asturias, Spain
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Miguel A. Alvarez
Instituto de Productos Lácteos de Asturias (IPLA, CSIC), 33300 Villaviciosa, Asturias, Spain
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: maag@ipla.csic.es
DOI: 10.1128/AEM.00295-08
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Additional Files
  • FIG. 1.
    • Open in new tab
    • Download powerpoint
    FIG. 1.

    Real-time qPCR analysis of 10-fold serial dilutions in skim milk of (A) plasmid pEM212 DNA digested with BglII and bacteriophage φP13.2 and (B) plasmid pEM213 DNA digested with BglII and bacteriophage φipla124. CT values were plotted against the logarithm of the calculated plasmid copy number or the number of PFU included in each reaction mixture.

Tables

  • Figures
  • Additional Files
  • TABLE 1.

    PCR primers and TaqMan MGB probes used in this study

    SpecificityPrimer or probeSequence (5′-3′)aPosition (bases)
    orf1510 b mgbPac2VIC-ACATGGCTGCATCTCT-MGB (P)13105-13120
    qPac1CGGGTGCTGGTTTCAATCA (F)13041-13060
    qPac2CTGCTGAGTTATCACTAATCGAACC (R)13143-13167
    orf18 c mgbCosFAM-TTGGTCGTTCTACTGTTAA-MGB (P)15874-15892
    qCos1TGCCATATCATGTTGAGATAAGGAC (F)15820-15844
    qCos2TGCATCAACAATTTTATCGCCTTG (R)15906-15929
    pEM125mgbICNED-CAAGCTCGAAATTAACCCTCACTAA-MGB (P)
    IC-FWGAGTAGGTCATTTAAGTTGAGCATAATAGG (F)
    IC-RCAAGCTCGAAATTAACCCTCACTAA (R)
    • ↵ a (F), forward primer; (R), reverse primer; (P), TaqMan MGB probe.

    • ↵ b orf1510 is the putative minor tail protein gene of the Sfi11 bacteriophage (accession no. AF158600).

    • ↵ c orf18 is the antireceptor gene of the Sf21 bacteriophage (accession no. AF115103).

Additional Files

  • Figures
  • Tables
  • Supplemental material

    Files in this Data Supplement:

    • Supplemental file 1 - Conditions employed in the qPCR experiments.
      MS Word document, 23K.
    • Supplemental file 2 - Bacterial strains and bacteriophages employed in the qPCR experiments (Table S2).
      MS Word document, 30K.
PreviousNext
Back to top
Download PDF
Citation Tools
Multiplex Fast Real-Time PCR for Quantitative Detection and Identification of cos- and pac-Type Streptococcus thermophilus Bacteriophages
Beatriz del Rio, María Cruz Martín, Noelia Martínez, Alfonso H. Magadán, Miguel A. Alvarez
Applied and Environmental Microbiology Jul 2008, 74 (15) 4779-4781; DOI: 10.1128/AEM.00295-08

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Applied and Environmental Microbiology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Multiplex Fast Real-Time PCR for Quantitative Detection and Identification of cos- and pac-Type Streptococcus thermophilus Bacteriophages
(Your Name) has forwarded a page to you from Applied and Environmental Microbiology
(Your Name) thought you would be interested in this article in Applied and Environmental Microbiology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Multiplex Fast Real-Time PCR for Quantitative Detection and Identification of cos- and pac-Type Streptococcus thermophilus Bacteriophages
Beatriz del Rio, María Cruz Martín, Noelia Martínez, Alfonso H. Magadán, Miguel A. Alvarez
Applied and Environmental Microbiology Jul 2008, 74 (15) 4779-4781; DOI: 10.1128/AEM.00295-08
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • Primer and probe design.
    • IC.
    • Quantification range and sensitivity.
    • Reproducibility and specificity of primers and probes.
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Polymerase Chain Reaction
Streptococcus Phages
Streptococcus thermophilus

Related Articles

Cited By...

About

  • About AEM
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #AppEnvMicro

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

 

Print ISSN: 0099-2240; Online ISSN: 1098-5336