Effects of Ammonium and Nitrite on Growth and Competitive Fitness of Cultivated Methanotrophic Bacteria

Growth and activity of pure cultures.

Methylomicrobium album ATCC 33003 (a gamma-MOB strain) and Methylocystis sp. strain ATCC 49242 (an alpha-MOB strain) were grown in batch cultures (consisting of 100 ml of medium in 250-ml Wheaton bottles sealed with septated screw-top lids) with nitrate mineral salts medium (NMS; ATCC medium 1306) or ammonium mineral salts medium (AMS; ATCC medium 784) containing 10 μM copper at pH 6.8 under a 50% air-50% methane atmosphere. Cultures were initiated with 1 × 10⁶ to 3 × 10⁶ cells ml⁻¹ and grown in the dark at 30°C with shaking (200 rpm). Although a range of NH₄Cl (25 to 100 mM) and NaNO₂ (0.5 to 5 mM) amendments were tested in both NMS and AMS (data not shown), 50 mM excess ammonium and 2.5 mM excess nitrite (the medium contained a 10 mM concentration of the respective N source) were selected for intensive investigation as these amounts caused differential responses by the bacteria but did not cause measurable osmotic effects. It must be recognized that bacteria in pure cultures have vastly different physiological responses from those operating in diverse natural communities; hence, while these N loads were necessary to stimulate measurable differential responses in the cultivated MOB, they are not directly applicable to MOB in natural environments.

M. album had shorter doubling times in AMS than in NMS (P = 0.03 by the t test), although final cell densities in the two media were equivalent as measured by direct microscopic counting using a Petroff-Hausser chamber under phase-contrast light microscopy (Table 1). Methylocystis sp. had equivalent doubling times and final cell densities when grown in NMS and AMS. Both strains released less nitrite when grown in AMS than in NMS, indicating more efficient uptake and assimilation of ammonium than nitrate as an N source (Table 1).

The addition of 2.5 mM nitrite decreased the initial doubling time for M. album in NMS but did not alter the overall growth curves (Fig. 1A and B) or methane consumption rates (Table 1) in either NMS or AMS as measured by gas chromatography (GC)-thermal conductivity detection (TCD) using a GC-8A instrument (Shimadzu) and a Hayesep Q column (Alltech). Final M. album cell densities were 29 and 36% lower in nitrite-amended than in unamended NMS and AMS, respectively (Table 1). Nitrite-amended cultures also showed net nitrite consumption (measured using a standard colorimetric assay [6]) and production of significantly more nitrous oxide (measured simultaneously with methane) than cultures with unamended medium. Amendment of Methylocystis sp. cultures with 2.5 mM nitrite significantly increased doubling times by 65 and 51%, increased methane consumption rates by 57 and 69%, and reduced final cell densities by 46 and 63% relative to those in unamended NMS and AMS, respectively (Table 1). Nitrite-amended cultures took 24 to 50 h longer to reach the end of exponential phase than unamended cultures (Fig. 1C and D). Unlike M. album cultures, Methylocystis sp. cultures accumulated nitrite in excess of the 2.5 mM amendment, and no nitrous oxide was detected in any Methylocystis sp. culture (Table 1).

• Open in new tab
• Download powerpoint

FIG. 1.

Growth curves for M. album in NMS (A) and AMS (B) and Methylocystis sp. in NMS (C) and AMS (D) without N amendment (•), with the addition of 2.5 mM NaNO₂ (○), and with the addition of 50 mM NH₄Cl (▿). Error bars represent standard errors for six replicate cultures as described in the text. Cells were enumerated by direct cell counting as described in the text.

The addition of 50 mM ammonium to M. album cultures increased doubling times, but not significantly, slowed methane consumption in NMS by 61%, and reduced final cell densities by 48 and 35% relative to those in unamended NMS and AMS, respectively (Table 1). Although similar amounts of nitrite were produced in ammonium-amended and unamended M. album cultures, no nitrous oxide was measured in ammonium-amended cultures. The addition of 50 mM ammonium to Methylocystis sp. cultures significantly increased doubling times and slowed methane consumption only in NMS, by 28 and 18%, respectively, and did not significantly alter final cell densities or nitrite production in any culture (Table 1; Fig. 1C and D).

Together, these results demonstrate that M. album was more tolerant to the inhibitory effects of nitrite than ammonium and that Methylocystis sp. was more tolerant to the inhibitory effects of ammonium than nitrite.

Growth and activity of cocultures.

Cocultures with equivalent initial numbers of M. album and Methylocystis sp. cells were challenged with either 2.5 mM excess nitrite or 50 mM excess ammonium added to NMS or AMS. The cocultures grew equally well in the two types of unamended media, consumed methane at similar rates, and reached similar final cell densities (Table 1). Enumeration of cells of the two isolates by quantitative PCR (qPCR) showed equivalent numbers in the cocultures from 0 to 24 h, at which point M. album outgrew Methylocystis sp., accounting for 80 to 90% of the population by 48 h (Fig. 2A). However, late into the period of zero net cell growth (60 h), the percentage of M. album cells decreased to 31 to 41% of the population while Methylocystis sp. became dominant. Interestingly, nitrite levels did not substantially increase in NMS or AMS cocultures and N₂O levels were lower than those in pure cultures of M. album, indicating more efficient N assimilation by the coculture than by either pure culture (Table 1).

• Open in new tab
• Download powerpoint

FIG. 2.

Individual growth curves for M. album (•, ○) and Methylocystis sp. (▪, □) in cocultures. Cells of the two isolates were enumerated separately by qPCR. Cocultures were grown in NMS (closed symbols) or AMS (open symbols) without N amendment (A), with the addition of 2.5 mM NaNO₂ (B), or with the addition of 50 mM NH₄Cl (C). Standard errors for replicated experiments (n = 6) are indicated by bars. R² values and PCR efficiency for standard curves with known cell numbers were 0.99 and 107% for M. album and 0.94 and 137% for Methylocystis sp.

For qPCR, primers were designed for M. album (Ma455F1, TCTGATGGCGAATACCCATC, and Ma856R, CACGAATCTTACGAATAAG) and Methylocystis sp. (Mcy177F1, GGATACGTGCGAGAGCAGA, and Mcy481R1, CCGTCATTATCGTCCCTGGC) by aligning their 16S rRNA genes using ClustalX (14). Primer sets were tested against both strains to ensure specificity. Standard curves were based on a dilution series of 10² to 10⁸ cell ml⁻¹ for each bacterium and verified by direct cell counting. Total DNA was extracted with a one-step, closed-tube cell lysis and DNA extraction system (ZyGem, New Zealand) with 100% efficiency. qPCRs (with 30-μl reaction mixtures) were performed using a MyIQ optical thermocycler (Bio-Rad, Hercules, CA) with one primer set at a time and with standard reagent concentrations for Taq polymerase, as follows: 95°C for 5 min and 45 cycles at 94°C (10 s), 60°C (20 s), 72°C (20 s), and 85°C (10 s) to measure the fluorescence from Sybr green I (Molecular Probes, Eugene, OR) while avoiding signals from primer-dimer pairs. Threshold cycle (C_T) values from the standards were used to extrapolate relative cell numbers in the samples.

The addition of 2.5 mM nitrite to the cocultures resulted in essentially no growth of Methylocystis sp. until well into the period of zero net change in cell numbers; 98 to 99% of growth through exponential phase was attributable to M. album, which also accounted for 94 to 97% of the population after 60 h of growth (Fig. 2B). Methane oxidation rates and final cell densities were unaffected by the addition of nitrite relative to those in unamended cocultures (Table 1). Doubling times increased only in NMS, by 37% relative to those in unamended cocultures. Levels of N₂O production in nitrite-amended cocultures were similar to that in nitrite-amended M. album pure cultures (Table 1).

Ammonium-amended cocultures showed equivalent growth of the two bacteria up to late log phase (36 h), at which point loss of M. album cells and growth of Methylocystis sp. resulted in dominance of the latter after 60 h (Fig. 2C). Addition of ammonium increased doubling times for the coculture by 25 and 37% relative to those for unamended NMS and AMS cocultures, respectively (Table 1). Ammonium amendment had no effect on final cell densities in either medium or on methane oxidation rates in AMS, but methane oxidation rates in NMS decreased by 11% relative to those in unamended cocultures. A small amount of nitrous oxide was detected in ammonium-amended cocultures, although far less nitrite was released into the media than in ammonium-amended pure cultures of either bacterium (Table 1).

Results from the cocultures indicate that M. album outcompeted Methylocystis sp. in the absence of challenge by high N loads (i.e., in unamended cocultures) and in the presence of high nitrite levels and that ammonium-amended cocultures provided greater competitive fitness to Methylocystis sp. Findings from prior studies indicate that Methylocystis isolates prefer low methane concentrations (18) or low oxygen concentrations (4), which may explain the resurgence of Methylocystis sp. following exponential cell growth.

Conclusions.

It is clear that ammonium and nitrite have strong effects on methanotrophic activity and, in ecological studies, on community composition. The present study demonstrates that competitive fitness of individual methanotrophic strains depends upon differential mechanisms to overcome inhibition and toxicity from imposed high N loads, as well as an ability to rapidly respond to and assimilate available nutrients. Consumption of nitrite and production of N₂O by M. album suggest that denitrifying ability may be an important mechanism for its relatively high tolerance of nitrite.