Article Figures & Data
Figures
- FIG. 1.
PCR confirmation of the Cyanothece sp. strain PCC 7822 ΔnifK mutant. PCR with primer 1 in the Spr cassette (Sp/11Up) and primer 2 in the nifK gene (7822 NifK2) produced a band of about 1.5 kb from ΔnifK mutant DNA (lane 1) but not from wild-type DNA (lane 3). Lane 2 is the 1-kb DNA ladder, and the 1.64- and 1.02-kb bands are highlighted. The 1.5-kb band in the ΔnifK mutant then was sequenced to demonstrate that the Spr cassette (Spec) was located within the nifK gene as shown in the scheme at the top.
- FIG. 2.
The Spr cassette was inserted into nifK at the EcoRI site as designed. The PCR product from the ΔnifK mutant was sequenced from a primer within the Spr cassette, Sp/Up (Table 1). The sequence underlined is the Spr cassette, and the rest is nifK. The GAATTC sequence shown in bold is the EcoRI site. Another sequencing result using a primer with nifK (7822 NifK3, Table 1) confirmed the insertion of the Spr cassette into nifK as well (data not shown).
- FIG. 3.
Growth of the Cyanothece sp. strain PCC 7822 wild type (WT) and the ΔnifK mutant in liquid media (A) and on plates (B). (A) The wild type and the ΔnifK mutant were grown in BG11 medium without combined nitrogen for 5 weeks. The mutant was unable to fix nitrogen and began to appear bleached after 1 week. (B) The wild type and the ΔnifK mutant were spotted onto BG11 plates with Sp (left) to demonstrate that the mutant, but not the wild type, was antibiotic resistant. The plate on the right contained no combined nitrogen and demonstrated that the wild type, but not the ΔnifK mutant, could fix nitrogen.
Tables
- TABLE 1.
Strains, plasmids, and primers used in this study
Strain, plasmid, or primer Relevant genotype, description, or sequence Source or reference E. coli strains KC8 Kmr RecA+lacΔ Clontech XL-1 Blue Tcr nalidixic acid resistant Agilent Technologies Cyanothece sp. strains ATCC 51142 Isolated from intertidal area near Port Aransas, TX Laboratory collection PCC 7424 Isolated from rice field soil, Senegal, 1972 Laboratory collection PCC 7425 Isolated from rice field soil, Senegal, 1972 Laboratory collection PCC 7822 Isolated from rice field soil at Central Rice Research Institute, Cuttack, Orissa, India Laboratory collection PCC 8801 Isolated from rice field soil (during spring), Ping-Tong District, southern Taiwan, as Synechococcus sp. strain RF-1 Laboratory collection PCC 8802 Isolated from rice field soil (during spring), Ping-Tong District, southern Taiwan, as Synechococcus sp. strain RF-2 Laboratory collection Plasmids pUC19 Cloning vector Laboratory collection pRL1383a RSF1010-derived broad-host-range vector, Spr and Smr, accession no. AF403426 10 pAM1037 Transposon Tn5 derivative (Kmr) 19 pRL448 Plasmid carrying Kmr cassette 8 pRL453 Plasmid carrying Sp/Sm Ω cassette 8 pHM54 NifK knockout construct for PCC 7822 with Spr cassette going against nifK This study pHM55 NifK knockout construct for PCC 7822 with Spr cassette going with nifK This study Primers 7822 NifK1 GCTATGACCATGATTACGCCAAGACCACGTTGAATTATTCC This study 7822 NifK2 GTTGTAAAACGACGGCCAGTGTACGATCGATATCTTCAAACAGAG This study 7822 NifK3 CGGCTGTCTTACCATGTAACCAAGC This study Sp/Up CCAAGGATCGGGCCTTGATG This study Sp/11Up CGTAACGCGCTTGCTGCTTG This study - TABLE 2.
Transformation efficiencya
Cyanothece sp. strain No. of transformants/CFU, 104 Kmr ratio (pAM1037/pRL448) No. of transformants/CFU, 104 Spr ratio (pRL1383a/pRL453) pAM1037 (Kmr) pRL448 (Kmr) pRL1383a (Spr) pRL453 (Spr) ATCC 51142 2.0 2.0 1.0 2.0 2.0 1.0 PCC 7424 1.0 1.0 1.0 1.0 1.0 1.0 PCC 7425 2.0 2.0 1.0 2.0 2.0 1.0 PCC 7822 1.0 0.2 5.0 1.0 0.01 100.0 PCC 8801 1.0 1.0 1.0 1.0 1.0 1.0 PCC 8802 1.0 1.0 1.0 1.0 1.0 1.0 ↵ a Six Cyanothece strains were transformed by transposon Tn5 derivative pAM1037 or broad-host-range plasmid pRL1383a in comparison with suicide vector pRL448 or pRL453, respectively. Only Cyanothece sp. strain PCC 7822 demonstrated a significantly lower background (transformation by suicide vectors) to evoke future mutagenesis by homologous recombination.
- TABLE 3.
Acetylene reduction activity and hydrogen production of Cyanothece sp. strain PCC 7822 and the ΔnifK mutant after incubation in air or argon
Cyanothece sp. strain PCC 7822 Incubation conditiona Avg relative acetylene reduction activityb ± SD Avg hydrogen production rateb ± SD Wild type Air 1 5.1 ± 1.8 ΔnifK mutant Air 2.7 ± 0.9 1.7 ± 2.5 Wild type Argon 31.5 ± 10.6 58 ± 16 ΔnifK mutant Argon 1,139 ± 363 2.4 ± 3.4 ↵ a Cultures were grown in medium containing N (2.5 mM NH4NO3) under low-light conditions for 10 days, washed with N-free medium twice, and grown in N-free medium for 3 days under low-light conditions. Then, 50 ml was added to 66-ml bottles. Some bottles were sparged with argon. Acetylene reduction assays were performed after the bottles were shaken under low-light conditions (30 μmol photons m−2 s−1) for 22 h. After injection of 3 ml of acetylene, the bottles were also kept under light for 2 h.
↵ b Activities were computed as milligrams of chlorophyll a per hour, and the acetylene reduction activities were normalized to the wild-type value obtained in air. Hydrogen production rates are in micromoles of H2 per milligram of chlorophyll a per hour.
