Article Figures & Data
Figures
- FIG. 1.
Vector map of plasmid pMTL-SC1. Expression of the hyperactive mariner transposase gene Himar1 C9 was driven by the C. difficile toxin B promoter, PtcdB. The control plasmid pMTL-SC0 was identical, except that there was no promoter driving expression of the transposase gene. The plasmid backbone consisted of the pBP1 replicon of C. botulinum (repA and orf2), the macrolide-lincosamide-streptogramin B antibiotic resistance gene ermB, the Gram-negative replicon ColE1, and the conjugal transfer function traJ. The whole mariner element (i.e., transposase gene and catP mini-transposon) can be excised as an SbfI fragment. The transcriptional terminators (Ω) are identical in sequence to those found immediately downstream of the fdx gene of Clostridium pasteurianum and the CD0164 open reading frame of C. difficile 630. This vector conforms to the pMTL80000 modular system for Clostridium shuttle plasmids (8).
- FIG. 2.
PCR screens of 17 randomly selected pMTL-SC1-derived Tmr clones. Genomic DNA prepared from each clone was screened for the transposon-based catP gene (A), the plasmid-based Himar1 C9 transposase gene (B), and an uninterrupted chromosomal tcdB promoter sequence (C). Lane M, 1-kb ladder (Promega); lane P, pMTL-SC1; lane wt, wild-type C. difficile R20291; lanes 1 to 17, pMTL-SC1-derived Tmr clones 1 to 17.
- FIG. 3.
Southern hybridization analysis of pMTL-SC1-derived Tmr clones. Genomic DNA samples were digested with HindIII. The membrane was probed for the transposon-based catP sequence. Lane wt, wild-type C. difficile R20291; lanes 1 to 17, pMTL-SC1-derived Tmr clones 1 to 17.
- FIG. 4.
Genetic map of mariner transposon insertions. Sixty independent transposon insertions were sequenced. Insertions in the plus orientation are marked on the circle exterior. Insertions in the minus orientation are marked on the circle interior. Numbers indicate the precise point of insertion according to genome sequence data for C. difficile R20291 (Refseq number NC_013316; GenBank accession number FN545816) (28).
Tables
- TABLE 1.
C. difficile minimal mediuma
Stock solution component Concn in stock solution (mg/ml) Final concn in CDMM (mg/ml) Amino acids (5×) Casamino Acids 50 10 l-Tryptophan 2.5 0.5 l-Cysteine 2.5 0.5 Salts (10×) Na2HPO4 50 5 NaHCO3 50 5 KH2PO4 9 0.9 NaCl 9 0.9 Glucose (20×) d-Glucose 200 10 Trace salts (50×) (NH4)2SO4 2.0 0.04 CaCl2·2H2O 1.3 0.026 MgCl2·6H2O 1.0 0.02 MnCl2·4H2O 0.5 0.01 CoCl2·6H2O 0.05 0.001 Iron (100×) FeSO4·7H2O 0.4 0.004 Vitamins (100×) d-Biotin 0.1 0.001 Calcium-d-pantothenate 0.1 0.001 Pyridoxine 0.1 0.001 ↵ a A 1-liter volume of C. difficile minimal medium (CDMM) was made by mixing 200 ml of 5× amino acids, 100 ml of 10× salts, 50 ml of 20× glucose, 20 ml of trace salts, 10 ml of 100× iron, and 10 ml of 100× vitamins with 610 ml sterile dH2O.
- TABLE 2.
Oligonucleotide primers
Primer name Sequence (5′-3′)a Function [restriction site(s)] PtcdB-F1 tgcggccgcTTAATGAATTTAAAGAAATATTTACAATAGAAATCAAATTTTAGAATTAAC Amplify tcdB promoter (NotI) PtcdB-R1 acatatgATTTTCTCCTTTACTATAATATTTTTATTGAATATTTTTACATCTAAATGC Amplify tcdB promoter (NdeI) HmrC9-F1 tatgttcatatgGAAAAAAAGGAATTTCGTGTTTTGATAAAATACTGTTTTCTGAAGGG Amplify Himar1 C9 transposase gene (NdeI)/PCR screening for Himar1 C9 transposase sequence HmrC9-R1 tatgttattaatTTATTCAACATAGTTCCCTTCAAGAGCGATACAACGATTATAACGACC Amplify Himar1 C9 transposase gene (AseI)/PCR screening for Himar1 C9 transposase sequence ITR1-F1 tatgtttacgtataacaggttggctgataagtccccggtctgacacaattgTTTTTCGGCAAGTGTTCAAGAAGTTATTAAGTCGGGAGTGCAGTCGAAGTGGG Amplify catP gene to yield transposon sequence (SnaBI/MfeI) ITR-R1 cagatgtttaaactaacaggttggctgataagtccccggtctaacaaaaaataagaagcctgcatttgcaggcttcttatttttaagcttAGACAAACCTGAAGTTAACTATTTATCAATTCCTGCAATTCGTTTACAAAACGG Amplify catP gene to yield transposon sequence (PmeI/HindIII) PtcdB-Fs1 GATAGAGAAATATCAGTGAAATTAAAAATATCTAGACAAGCTGTTAATAAGG PCR screening of chromosomal tcdB promoter PtcdB-Rs1 ATTGCTACATATTCATCTTCCTGAACACGAAATCTTACATTTGCC PCR screening of chromosomal tcdB promoter catP-F1 GGCAAGTGTTCAAGAAGTTATTAAGTCGGGAGTGCAGTCGAAGTGG PCR screening for transposon based catP gene and Southern probe synthesis catP-R1 TGAAGTTAACTATTTATCAATTCCTGCAATTCGTTTACAAAACGG PCR screening for transposon based catP gene and Southern probe synthesis catP-INV-F1 TAAATCATTTTTAGCAGATTATGAAAGTGATACGCAACGGTATGG Inverse PCR catP-INV-R1 TATTGTATAGCTTGGTATCATCTCATCATATATCCCCAATTCACC Inverse PCR catP-INV-R2 TATTTGTGTGATATCCACTTTAACGGTCATGCTGTAGGTACAAGG Sequencing of inverse PCR products ↵ a Bases in capitals are complementary to the target sequence. Underlining indicates recognition sequences of the corresponding restriction endonucleases listed in the final column. Boldface indicates the mariner ITR sequences. Italics indicate the fdx terminator sequence of C. pasteurianum.
- TABLE 3.
Plasmid replicon performance in C. difficile R20291
Gram-positive replicon Source of replicon Replicon contexta Conjugation frequency into R20291b Segregational stability in R20291c Organism Reference(s) pBP1 C. botulinum 8 pMTL82151 (2.61 ± 0.04) × 10−7 57.2 (± 0.7) pCB102 C. butyricum 4, 18 pMTL83151 (3.40 ± 1.90) × 10−8 55.9 (± 1.1) pCD6 C. difficile 23 pMTL84151 (4.48 ± 0.47) × 10−7 76.0 (± 0.7) pIM13 B. subtilis 1, 19 pMTL85151 —d —d ↵ a Each Gram-positive replicon was tested in an identical shuttle vector context consisting of the chloramphenicol/thiamphenicol resistance gene catP, the Gram-negative replicon ColE1, the conjugal transfer function traJ, and a lacZα multiple cloning site (8).
↵ b Conjugation frequencies were calculated as the number of transconjugant colonies per CFU of E. coli donor.
↵ c Segregational stabilities were calculated as percent stability per generation as described in Materials and Methods.
↵ d The pIM13-based plasmid pMTL85151 could not be transferred into C. difficile R20291.
- TABLE 4.
Transposon insertion sites in C. difficile R20291 mutants
Phenotype Transposon insertion sitea Location in genome (nt)b ORF interruptedc Description spo/ger− TGGGAACACGTATGCAACTA— Tn—TATAACTGGTACAGCAGCAG 2517626 cspBA (CDR20291_2147) Putative germination specific protease Auxotroph TCCCTTTATAGCTTCTTTTA— Tn—TATATAATCTGGCATTTTTA 238739 pyrB (CDR20291_0185) Aspartate carbomoyltransferase catalytic chain
