Article Figures & Data
Figures
- Fig 1
Venn diagram for gull-specific assay positives against gull feces (top) and water impacted with gull fecal contamination (bottom). Numbers outside the circles represent numbers of samples that tested negative with all assays.
- Fig 2
Mean copy numbers of target markers in gull fecal DNA in samples positive and negative with the gull3 assay. To calculate mean concentrations, below detection limits were treated as zero, and double-peak values from the gull2 assay were not considered. Error bars represent one standard deviation.
- Fig 3
Mean copy numbers of markers in fecal DNA extracts. To calculate mean concentrations, the below detection limit values were treated as zero, and double-peak values from the gull2 assay were not considered. Error bars represent one standard deviation. The gull2 marker was not detected in any of crane and snow goose fecal samples.
- Fig 4
Probability of gull fecal contamination using a Bayesian statistical model. (A) Posterior probability of contamination given a positive qPCR result using three different gull-specific assays over a range of prior probabilities; (B) posterior probability of contamination given a negative qPCR result using three different gull-specific assays over a range of prior probabilities.
Tables
- Table 1
Summary of oligonucleotide primers and probes for gull-specific qPCR assays
Assay Primer/probe sequence (5′ to 3′) Ta (°C)a Size (bp) Reference or source gull2 SYBR green Forward: TGCATCGACCTAAAGTTTTGAG 64 412 24 Reverse: GTCAAAGAGCGAGCAGTTACTA 64 412 24 gull3 SYBR green SAG1F: ATTTAACCCATGTTAGATGC 56 319 This study SAG1R: CGTCCCTTTCTGGTAAGT 56 319 This study gull4 TaqMan qGull7F: CTTGCATCGACCTAAAGTTTTGAG 60 116 This study qGull8R: GGTTCTCTGTATTATGCGGTATTAGCA 60 116 This study qGull7Pb: FAM-ACACGTGGGTAACCTGCCCATCAGA-TAMRA 60 116 This study - Table 2
Distribution of 16S rRNA genes in the clone library of gull feces
Class or group % clones of total Genus No. of clonesa This study (n = 354) Lu et al. (n = 282) This study Lu et al. Fusobacteria 3.1 0.7 Cetobacterium 11 2 Bacilli 69.2 37.2 Bacillus 0 3 Weissella 5 0 Lactobacillus 6 9 Streptococcus 116 0 Catellicoccus 68 74 Unclassified Lactobacillales 50 7 Clostridia 3.1 17.3 Dialister 1 0 Subdoligranulum 3 0 Clostridium 3 44 Unknown 2 2 Erysipelotrichi 0.9 0 Turicibacter 1 – Unknown 2 Alphaproteobacteria 0.3 6.7 Rubellimicrobium 1 0 Paracoccus 0 8 Betaproteobacteria 0 4.3 Acidovorax – 6 Epsilonproteobacteria 0.3 0.4 Campylobacter 1 1 Gammaproteobacteria 16.7 11.3 Acinetobacter 0 13 Enterobacter 1 6 Escherichia 0 6 Citrobacter 3 0 Shigella 6 0 Klebsiella 17 5 Unknown 32 0 Sphingobacteria 0.6 0 Unknown 2 – Actinobacteria 0.6 6.4 Corynebacterium 0 8 Unknown 2 3 Mollicutes 0.3 0 Ureaplasma 1 – Bacteroidetes 0 1.1 Bacteroides – 1 Unknown 5.1 3.2 Unknown 18 9 ↵a –, not found.
- Table 3
Prevalence of gull markers in various animal feces
Animal type Animal Location of samples No. of samples No. of positive samples SYBR green TaqMan, gull4 gull2 gull3 Gull California gull (Larus californicus) California 159 138 44 143 Ring-billed gull (L. delawarensis) Ohio 2 2 2 2 Glaucous-winged gull (L. glaucescens) Alaska 64 53 2 50 Laughing gull (L. atricilla) Georgia 5 5 2 2 Laughing gull (L. atricilla) Delaware 3 2 3 3 Herring gull (L. smithsonianus) Delaware 20 16 16 18 Gray headed gull (L. cirrocephalus) South Africa 2 2 2 2 Total 255 218 71 221 Poultry and waterfowl Chicken (houses) Puerto Rico 98 12 23 8 Turkey Puerto Rico 5 0 5 0 Duck Puerto Rico 16 0 16 0 Pigeon Puerto Rico 11 1 2 2 Heron Puerto Rico 1 0 0 0 Swan Puerto Rico 22 0 9 0 Guineafowl Puerto Rico 11 0 1 0 Crane Nebraska 12 0 2 8 Snow geese Nebraska 10 0 0 4 Pelican California 10 10 10 10 Red Knot Delaware 17 1 0 1 Turnstone Delaware 5 2 1 1 Canada geese Alaska 25 6 0 4 Mallard Alaska 6 0 1 0 Total 249 32 76 38 Nonavian species Cattle Puerto Rico 66 0 5 0 Goat Puerto Rico 32 0 5 0 Monkey Puerto Rico 9 0 0 0 Fish Puerto Rico 13 1 0 0 Horse Puerto Rico 30 1 3 0 Pig Puerto Rico 30 8 13 1 Total 180 10 27 1 - Table 4
Detection of gull markers in water samples by gull-specific assays
Sampling location(s) Sample type Sampling period No. of water samples No. of samples positive with: Presumed primary fecal contamination sourcea gull2 gull3 gull4 California beach Freshwater and seawater May to September 2008 338 293 202 312 Gull Delaware beach Freshwater and seawater May 2011 6 5 4 6 Gull Anchorage, AK Freshwater October 2010 5 1 1 1 Gull Anchorage, AK Freshwater October 2010 3 0 0 0 Unknown Toronto, Canada Water treatment plant intake (Lake Ontario offshore) December 2009 9 0 0 0 Unknown Toronto, Canada Sewage treatment plant effluent December 2009 3 0 0 0 Human, gull Toronto, Canada Sewage treatment plant effluent and CSO samplesb December 2009 6 0 0 0 Human Sumas watershed, BC, Canada (agriculture-impacted sites) Freshwater April 2007 to December 2007 64 12 26 10 Chicken, some livestock Sumas Watershed, BC, Canada (reference site) Freshwater April 2007 to December 2007 16 1 5 2 Wildlife Puerto Rico Freshwater September 2010 to January 2011 138 0 19 0 Domesticated animals (including chicken) - Table 5
Bayesian statistics for the three qPCR assays against gull-impacted water samplesa
Assay Conditional probability Sensitivity Specificity Prevailing rate gull2 0.98 0.85 0.90 0.86 gull3 0.63 0.28 0.76 0.59 gull4 0.99 0.87 0.91 0.91 ↵a The conditional probability [i.e., posterior probability or P(A|B) in the Bayesian formula] was calculated using a Bayesian statistical model. The sensitivity is the ratio of positive signals in gull fecal samples. It is numerically identical to P(B|A) in the Bayesian formula. The specificity is the ratio of negative signals in nongull fecal samples. It is numerically identical to 1 − P(B|A′) in the Bayesian formula. The prevailing rate is the ratio of positive signals in water samples. It is numerically identical to P(A) in the Bayesian formula.
