Investigation of the Relationship between Lactococcal Host Cell Wall Polysaccharide Genotype and 936 Phage Receptor Binding Protein Phylogeny

Jennifer Mahony; Witold Kot; James Murphy; Stuart Ainsworth; Horst Neve; Lars H. Hansen; Knut J. Heller; Søren J. Sørensen; Karin Hammer; Christian Cambillau; Finn K. Vogensen; Douwe van Sinderen

doi:10.1128/AEM.00653-13

DOI: 10.1128/AEM.00653-13

Article Figures & Data

Figures

Tables
Additional Files

Open in new tab
Download powerpoint
Fig 1
Comparison of the genomic regions encoding the CWPS biosynthesis clusters of six lactococcal strains (UC509.9, CV56, IL1403, KF147, SK11, and MG1363). Homologous protein-encoding genes are joined by gray blocks including the level of identity (percent amino acids) relative to UC509.9. The three subgroups of CWPS are the UC509.9/CV56 (UC/CV) (CWPS A), the IL1403/KF147 (IL/KF) (CWPS B), and the MG1363/SK11 (MG/SK) (CWPS C) subgroups, with unique regions in the operons of UC509.9, IL1403, and MG1363 in the schematic highlighted by stars to indicate the genes upon which the multiplex PCRs are based. The control for the multiplex PCR was based on the rmlB gene, which is conserved in each of the strains.
Open in new tab
Download powerpoint
Fig 2
Representative phylogenetic tree of the RBP variable C termini of 32 936 phages, including the 11 sequenced phages of this study. Three major groups of the 936 RBPs are observed: group I includes the majority of phages in this study that infect strains with a MG/SK CWPS (except 936), group II includes those phages in this study that infect strains with an IL/KF CWPS, and group III represents a small group with a divergent RBP that predominantly infects strains with an IL/KF CWPS but also infects a strain with the MG/SK CWPS with equal efficiency.
Open in new tab
Download powerpoint
Fig 3
Representative electron micrographs of each of the 11 phages used in this study. The phages are grouped according to the RBP grouping assigned in this study (RBP groups I, II, and III). Where a collar-like structure is observed, it is highlighted with an asterisk in the image.

Table 1

Features of the lactococcal strains used in this study

Strain	Reference or source^a	Organism	CWPS type	Infected by phage(s)
IL1403	35	L. lactis subsp. lactis	IL/KF (B)	+
F7/2	36	L. lactis subsp. lactis biovar diacetylactis	IL/KF (B)	+
Bu2-60	37	L. lactis subsp. lactis	IL/KF (B)	+
455	Dupont-Danisco	L. lactis subsp. cremoris	IL/KF (B)	+
UC77	UCC	L. lactis subsp. cremoris	IL/KF (B)	+
229	UCC	L. lactis subsp. lactis	IL/KF (B)	−
WM1	UCC	L. lactis subsp. lactis	UC/CV (A)	−
ML8	1	L. lactis subsp. cremoris	UC/CV (A)	−
C10	UCC	L. lactis subsp. cremoris	UC/CV (A)	−
IE-16	1	L. lactis subsp. cremoris	UC/CV (A)	−
SMQ-450	1	L. lactis subsp. cremoris	UC/CV (A)	−
SMQ-562	1	L. lactis subsp. cremoris	UC/CV (A)	−
111	1	L. lactis subsp. cremoris	UC/CV (A)	−
UC063	UCC	L. lactis subsp. cremoris	UC/CV (A)	−
UC509.9	UCC	L. lactis subsp. cremoris	UC/CV (A)	−
UL8	UCC	L. lactis subsp. lactis	UC/CV (A)	−
275	UCC	L. lactis subsp. lactis	UC/CV (A)	−
KH	28	L. lactis subsp. cremoris	UC/CV (A)	−
C3	38	L. lactis subsp. cremoris	UC/CV (A)	−
W22	39	L. lactis subsp. cremoris	MG/SK (C)	+
W34	7	L. lactis subsp. cremoris	MG/SK (C)	+
3107	40	L. lactis subsp. cremoris	MG/SK (C)	+
WG2	36	L. lactis subsp. cremoris	MG/SK (C)	+
FD13	9	L. lactis subsp. cremoris	MG/SK (C)	+
H2	41	L. lactis subsp. cremoris	MG/SK (C)	+
158	34	L. lactis subsp. cremoris	MG/SK (C)	+
V32.2	42	L. lactis subsp. cremoris	MG/SK (C)	+
JM3	UCC	L. lactis subsp. cremoris	MG/SK (C)	+
JM2	UCC	L. lactis subsp. cremoris	MG/SK (C)	+
1196	UCC	L. lactis subsp. cremoris	MG/SK (C)	+
SMQ86	1	L. lactis subsp. cremoris	MG/SK (C)	−
US3	43	L. lactis subsp. cremoris	MG/SK (C)	−
E8	KU	L. lactis subsp. cremoris	MG/SK (C)	+
MG1614	44	L. lactis subsp. cremoris	MG/SK (C)	−
901-1	40	L. lactis subsp. cremoris	MG/SK (C)	−
184	UCC	L. lactis subsp. lactis	Unknown	−

↵a UCC, University College Cork.

Table 2

Features of the phages used in this study

Phage	Source or reference	Source location	Yr of first report/isolation	Propagating host	Genome length (kb)	G+C content (%)	No. of ORFs	RBP group
fd13	KU	Denmark	2004	FD13	30.674	34.7	53	I
P113g	9	Germany	1986	IL1403	30.796	34.1	58	II
P272	9	Germany	1986	IL1403	30.778	34.1	61	II
936	34	New Zealand	1984	158	27.302	34.5	49	II
P475	Danisco Culto^a	Europe	Unknown	455	30.961	34.3	57	III
P680	Z. Atamer and J. Hinrichs^b	Germany	2009	IL1403	29.631	35.1	49	II
7	KU	Denmark	2004	V32.2	32.382	34.2	57	I
645	This study	Denmark	2004	IL1403	29.247	35.0	51	III
340	This study	Denmark	2010	IL1403	32.337	34.5	58	III
ViridusJM2	This study	Ireland	2010	JM2	31.090	34.3	59	I
PastusJM3	This study	Ireland	2010	JM3	28.674	34.4	52	I

↵a Danisco Cultor Niebüll GmbH, Niebüll, Germany.
↵b University of Hohenheim, Germany.

Table 3

Primers for CWPS multiplex PCR

Primer	Sequence (5′–3′)	Product size (bp)
IL-KFfw	GATTCAGTTGCACGGCCG
IL-KFrv	AGTAAGGGGGCGGATTGTG	183
MG-SKfw	AAAGCTCATCTTTCCCCTGTTGT
MG-SKrv	GCACCATAGTCTGGAATAAGACC	686
UC-CVfw	GTGCCTATGCTCCGTTAGTC
UC-CVrv	CGAGGGCCAATCTCTTTACC	442
CONfw (control)	GTACACTATGTTTATAACAATCATCCAG
CONrv	GCAAACCAGATTCAAAGTCAGTATG	891

Table 4
Host range of phages assessed in this study^a
↵a In gray-shaded blocks are the phages that group into RBP groups I (7, fd13, JM2, and JM3), II (P680, P113g, P272, and 936), and III (P475, 645, and 340).

Additional Files

Figures
Tables

Files in this Data Supplement:

Supplemental file 1 -
Orf predictions for 936 and representative ORFs on the sequenced phages (Table S1).

PDF, 224K

Supplemental file 2 -
Multiplex PCR for the detection of conserved regions and differential regions of the CWPS cluster of lactococcal genomes (Fig. S1).

PDF, 139K