Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My alerts
  • My Cart

Main menu

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AEM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My alerts
  • My Cart

Search

  • Advanced search
Applied and Environmental Microbiology
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Current Issue
    • Accepted Manuscripts
    • COVID-19 Special Collection
    • Archive
    • Minireviews
  • For Authors
    • Submit a Manuscript
    • Scope
    • Editorial Policy
    • Submission, Review, & Publication Processes
    • Organization and Format
    • Errata, Author Corrections, Retractions
    • Illustrations and Tables
    • Nomenclature
    • Abbreviations and Conventions
    • Publication Fees
    • Ethics Resources and Policies
  • About the Journal
    • About AEM
    • Editor in Chief
    • Editorial Board
    • For Reviewers
    • For the Media
    • For Librarians
    • For Advertisers
    • Alerts
    • RSS
    • FAQ
  • Subscribe
    • Members
    • Institutions
Biodegradation

Roles of Two Glutathione-Dependent 3,6-Dichlorogentisate Dehalogenases in Rhizorhabdus dicambivorans Ndbn-20 in the Catabolism of the Herbicide Dicamba

Na Li, Ren-Lei Tong, Li Yao, Qing Chen, Xin Yan, De-Rong Ding, Ji-Guo Qiu, Jian He, Jian-Dong Jiang
Ning-Yi Zhou, Editor
Na Li
aKey Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture, College of Life Sciences, Nanjing Agricultural University, Nanjing, Jiangsu, China
bSchool of Life Science and Technology, Nanyang Normal University, Nanyang, Henan, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ren-Lei Tong
aKey Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture, College of Life Sciences, Nanjing Agricultural University, Nanjing, Jiangsu, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Li Yao
cSchool of Marine and Biological Engineering, Yancheng Teachers University, Yancheng, Jiangsu, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Qing Chen
dCollege of Life Sciences, Zaozhuang University, Zaozhuang, Shandong, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Xin Yan
aKey Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture, College of Life Sciences, Nanjing Agricultural University, Nanjing, Jiangsu, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
De-Rong Ding
eBeijing DBN Biotech Co., Ltd., Beijing, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ji-Guo Qiu
aKey Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture, College of Life Sciences, Nanjing Agricultural University, Nanjing, Jiangsu, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jian He
aKey Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture, College of Life Sciences, Nanjing Agricultural University, Nanjing, Jiangsu, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jian-Dong Jiang
aKey Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture, College of Life Sciences, Nanjing Agricultural University, Nanjing, Jiangsu, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ning-Yi Zhou
Shanghai Jiao Tong University
Roles: Editor
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/AEM.00623-18
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

ABSTRACT

The herbicide dicamba is initially demethylated to 3,6-dichlorosalicylate (3,6-DCSA) in Rhizorhabdus dicambivorans Ndbn-20 and is subsequently 5-hydroxylated to 3,6-dichlorogentisate (3,6-DCGA). In the present study, two glutathione-dependent 3,6-DCGA dehalogenases, DsmH1 and DsmH2, were identified in strain Ndbn-20. DsmH2 shared a low identity (only 31%) with the tetrachlorohydroquinone (TCHQ) dehalogenase PcpC from Sphingobium chlorophenolicum ATCC 39723, while DsmH1 shared a high identity (79%) with PcpC. In the phylogenetic tree of related glutathione S-transferases (GSTs), DsmH1 and DsmH2, together with PcpC and the 2,5-dichlorohydroquinone dehalogenase LinD, formed a separate clade. DsmH1 and DsmH2 were synthesized in Escherichia coli BL21 and purified as His-tagged enzymes. Both enzymes required glutathione (GSH) as a cofactor and could 6-dechlorinate 3,6-DCGA to 3-chlorogentisate in vitro. DsmH2 had a significantly higher catalytic efficiency toward 3,6-DCGA than DsmH1. Transcription and disruption analysis revealed that DsmH2 but not DsmH1 was responsible for the 6-dechlorination of 3,6-DCGA in strain Ndbn-20 in vivo. Furthermore, we propose a novel eta class of GSTs to accommodate the four bacterial dehalogenases PcpC, LinD, DsmH1, and DsmH2.

IMPORTANCE Dicamba is an important herbicide, and its use and leakage into the environment have dramatically increased since the large-scale planting of genetically modified (GM) dicamba-resistant crops in 2015. However, the complete catabolic pathway of dicamba has remained unknown, which limits ecotoxicological studies of this herbicide. Our previous study revealed that 3,6-DCGA was an intermediate of dicamba degradation in strain Ndbn-20. In this study, we identified two glutathione-dependent 3,6-DCGA dehalogenases, DsmH1 and DsmH2, and demonstrated that DsmH2 is physiologically responsible for the 6-dechlorination of 3,6-DCGA in strain Ndbn-20. GSTs play an important role in the detoxification and degradation of a variety of endogenous and exogenous toxic compounds. On the basis of their sequence identities, phylogenetic status, and functions, the four bacterial GSH-dependent dehalogenases (PcpC, LinD, DsmH1, and DsmH2) were reclassified as a new eta class of GSTs. This study helps us to elucidate the microbial catabolism of dicamba and enhances our understanding of the diversity and functions of GSTs.

INTRODUCTION

Dicamba (3,6-dichloro-2-methoxybenzoate) is an important herbicide that kills a variety of broadleaf weeds, including many glyphosate- and bialaphos-resistant weeds (1, 2). The biotech company Monsanto has developed a genetically modified (GM) soybean (Roundup Ready 2 Xtend) that is resistant to dicamba and glyphosate and a GM cotton (Bollgard II XtendFlex) that is resistant to dicamba and bialaphos. These GM crops have been commercially planted since 2015 (3). In 2017, the planting area of Roundup Ready 2 Xtend soybean exceeded 20 million acres, and its planting area in 2018 is expected to be more than 40 million acres. The use of dicamba correspondingly increased from 13,000 tons in 2015 to 30,000 tons in 2017. The catabolism and ecological effects of dicamba thus need to be clarified. In the environment, dicamba is mainly degraded through microbial catabolism (4–7). The initial degradation step of dicamba is demethylation, generating 3,6-dichlorosalicylate (3,6-DCSA), catalyzed by a dicamba monooxygenase (DMO) in Stenotrophomonas maltophilia DI-6 (4) or a tetrahydrofolate (THF)-dependent dicamba methyltransferase (Dmt) in Rhizorhabdus dicambivorans Ndbn-20 (5, 6). 3,6-DCSA is subsequently 5-hydroxylated to 3,6-dichlorogentisate (3,6-DCGA) by a three-component cytochrome P450 monooxygenase system (DsmABC) in strain Ndbn-20 (8). Moreover, Werwath et al. identified a gentisate 1,2-dioxygenase (GtdA) that was able to cleave 3,6-DCGA in vitro from dicamba-degrading Sphingomonas sp. strain RW5 (7). However, the cleavage of 3,6-DCGA by GtdA has not been studied in vivo.

Halogenated compounds are an important and diverse class of natural and synthetic chemicals. They are widely used as solvents, defatting agents, fungicides, and herbicides in the chemical and agricultural industries (9, 10). However, halogenated compounds are generally highly toxic and environmentally persistent (11). Thus, their dissipation in the environment and catabolism by microbes have received considerable attention (12, 13). Microbial dehalogenation increases the biodegradability of halogenated compounds, thus playing a key role in the biodegradation and detoxification of halogenated aromatics (14–16). To date, four types of dehalogenation mechanisms, oxidative, hydrolytic, reductive, and thiolytic dehalogenations, have been identified (10, 17). In oxidative dehalogenation, the halogen is replaced by a hydroxyl group whose oxygen atom comes from dioxygen (17). In hydrolytic dehalogenation, the halogen is replaced by a hydroxyl group whose oxygen atom comes from water (10). In reductive dehalogenation, the halogenated aromatics serve as terminal electron acceptors under strictly anaerobic conditions; thus, reductive dehalogenation is also referred to as halorespiration (18, 19). In thiolytic dehalogenation, chlorinated aromatics are dehalogenated by nucleophilic attack by a thiolate anion of reduced glutathione (GSH) under the catalysis of glutathione S-transferases (GSTs) (20, 21). To date, only a few GST-type dehalogenases, such as the tetrachlorohydroquinone (TCHQ) dehalogenase PcpC from Sphingobium chlorophenolicum (formerly a Flavobacterium sp.) ATCC 39723 (20, 22) and the 2,5-dichlorohydroquinone (2,5-DCHQ) dehalogenase LinD from Sphingomonas paucimobilis UT26 (23), have been reported. PcpC catalyzes a two-step dehalogenation of TCHQ to trichlorohydroquinone (TriCHQ) and then to 2,6-DCHQ during the degradation of the fungicide pentachlorophenol, and LinD catalyzes the dechlorination of 2,5-DCHQ to chlorohydroquinone (CHQ) and then to hydroquinone (HQ) in the catabolism of lindane.

In this study, we identified two GST-type dehalogenases, DsmH1 and DsmH2, from strain Ndbn-20. Both dehalogenases catalyzed the 6-dechlorination of 3,6-DCGA to generate 3-chlorogentisate in vitro. The enzymatic characteristics and physiological roles of DsmH1 and DsmH2 in the catabolism of 3,6-DCGA and dicamba were investigated. In addition, on the basis of the results of phylogenetic analysis and enzymatic characteristics, the four bacterial GSH-dependent dehalogenases, DsmH1, DsmH2, PcpC, and LinD, represent a novel class of GSTs, for which the name “eta” is proposed.

RESULTS

3,6-DCGA is dechlorinated via a GSH-dependent dehalogenase in strain Ndbn-20.To identify the genes responsible for the degradation of 3,6-DCGA in strain Ndbn-20, we first studied the metabolite of 3,6-DCGA transformed by the cell lysate. The cell lysate of strain Ndbn-20 could transform 3,6-DCGA in the presence of GSH but not in the presence of NAD(P)H or ATP. Ultra-high-performance liquid chromatography (UHPLC) analysis showed that a metabolite with a retention time of 5.40 min was generated (Fig. 1A). Mass spectrometry (MS) analysis showed a prominent deprotonated molecular ion peak at m/z 187.0 (M-H)− (Fig. 1B), which was equal to the theoretical molecular weight of the dechlorinated product of 3,6-DCGA with a chlorine being replaced by a hydrogen (the 3,6-DCGA molecular weight of 220.9 minus the chlorine molecular weight of 35 plus the hydrogen molecular weight of 1). This result indicated that 3,6-DCGA is dechlorinated by a GSH-dependent dehalogenase in strain Ndbn-20.

FIG 1
  • Open in new tab
  • Download powerpoint
FIG 1

UHPLC/MS analysis of the metabolite generated during degradation of 3,6-DCGA by the cell lysate of R. dicambivorans Ndbn-20. (A) UHPLC spectrum of the metabolite. The detection wavelength was 330 nm. mAU, milli-absorbance units. (B) Mass spectrum of the metabolite at 5.40 min.

Prediction of the dehalogenase gene involved in dechlorination of 3,6-DCGA in the genome of strain Ndbn-20.To find the putative 3,6-DCGA dehalogenase gene, the amino acid sequences of the GSH-dependent dehalogenases PcpC and LinD were used for BLASTP searches against the genome of strain Ndbn-20. These searches resulted in the identification of three putative genes (ORF03780, ORF14585, and ORF18325). ORF03780 encodes a putative dehalogenase (248 amino acids) that shares 79% and 25% identities with PcpC and LinD, respectively. ORF14585 encodes a putative GST (266 amino acids) that is most closely related to LigF (31% identity), cleaves the β-aryl ether linkage of lignin compounds in Sphingomonas paucimobilis SYK-6 (24), and exhibits 28% identity with PcpC. ORF18325 encodes a putative dehalogenase (246 amino acids) that shows 31% and 26% identities with PcpC and LinD, respectively. ORF18325 is located in a gene cluster that contains three other open reading frames (ORFs): ORF18315 encodes a gentisate 1,2-dioxygenase (GtdA), ORF18320 encodes a fumarylpyruvate hydrolase, and ORF18330 encodes a glutathione disulfide reductase (Fig. 2A and Table 1). Furthermore, two transposase genes (ORF18310, ORF18345) are found upstream and downstream of this cluster, respectively. It is interesting that this cluster is also present in two additional dicamba-utilizing strains, Sphingomonas sp. strain RW5 (7) and Sphingobium sp. strain hm-6-1, isolated by our lab (Key Laboratory of Agricultural Environmental Microbiology, Nanjing Agricultural University, Jiangsu, China; unpublished data). These evidences suggest that this gene cluster is located in a transferable element that can be horizontally transferred among sphingomonads.

FIG 2
  • Open in new tab
  • Download powerpoint
FIG 2

Organization of genes in the vicinity of ORF18325 (dsmH2) and proposed partial metabolic pathway of dicamba in R. dicambivorans Ndbn-20. (A) Organization of genes in the vicinity of ORF18325 (dsmH2). Arrows indicate the sizes and transcriptional direction of each gene. (B) Proposed partial catabolic pathway of dicamba in R. dicambivorans Ndbn-20. Dmt, dicamba methyltransferase; DsmABC, 3,6-DCSA hydroxylase; DsmH2, 3,6-DCGA dehalogenase; GtdA, gentisate 1,2-dioxygenase. The functions of Dmt and GtdA were cited from references 5 and 7, respectively; the function of DsmH2 was confirmed in this study; the function of ORF18320 was predicted from comparison of its homology with known genes.

View this table:
  • View inline
  • View popup
TABLE 1

Deduced functions of ORFs in the vicinity of dsmH2

3,6-DCGA dehalogenase activity assay of the proteins encoded by the three putative genes.To test their activity against 3,6-DCGA, the three putative dehalogenases were individually synthesized in Escherichia coli BL21(DE3). The C-terminal His6-tagged proteins were purified to apparent homogeneity using Co2+ chelate affinity chromatography. Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) analysis showed that the molecular weights of the three recombinant proteins were all approximately 28 kDa (see Fig. S1 in the supplemental material), which was in agreement with their deduced molecular weights (28.64, 30.26, and 29.09 kDa, respectively). Enzymatic assays showed that both the ORF03780- and ORF18325-encoded proteins displayed 3,6-DCGA dehalogenase activity, whereas the ORF14585-encoded protein did not (Fig. 3). UHPLC and UV spectroscopic analysis showed that a new product with a retention time of 5.39 min (Fig. S2A) and a maximum absorption at 325 nm (Fig. 3A and C) was generated. MS analysis showed that the product had a prominent deprotonated molecular ion peak at m/z 187.0 (M-H)− (Fig. S2B), which was equal to that of a predicted 3,6-DCGA metabolite after the elimination of a chlorine atom. Thus, this product was identified as 3- or 6-chlorogentisate. In this study, ORF03780 and ORF18325 were designated dsmH1 and dsmH2, respectively.

FIG 3
  • Open in new tab
  • Download powerpoint
FIG 3

Spectrophotometric changes during the transformation of 3,6-DCGA by the proteins encoded by ORF03780 (dsmH1) (A), ORF14585 (B), and ORF18325 (dsmH2) (C). The reaction was initiated by the addition of 3,6-DCGA. The arrows indicate the direction of spectral changes. The UV spectra were recorded from 260 to 400 nm every 2 min for panels A and B and every 30 s for panel C.

Determination of the dechlorination position in 3,6-DCGA.There are two chlorine atoms in 3,6-DCGA. 1H nuclear magnetic resonance (NMR) analysis was used to determine which chlorine atom was eliminated from 3,6-DCGA. The 1H NMR spectra of 3,6-DCGA and the dechlorinated product purified from the enzymatic reaction mixture are shown in Fig. 4. In the 1H NMR spectrum of 3,6-DCGA, a peak of δ 7.0181 ppm corresponding to the only hydrogen atom on the benzene ring was detected (Fig. 4A). In the 1H NMR spectrum of the dechlorinated product, two split peaks, one set of δ 7.1914 ppm and 7.1972 ppm and one set of δ 7.1244 ppm and 7.1302 ppm, corresponding to the two hydrogen atoms on the benzene ring were detected (Fig. 4B). In previous reports, the coupling constant (J) of the ortho aromatic hydrogen atoms appeared in the region from 8 to 12 Hz, whereas the J value of the meta aromatic hydrogen atoms ranged from 2 to 3 Hz (25). In this study, the J value of the two aromatic hydrogen atoms was determined to be 2.9 Hz (Fig. 4B), which indicated that the two hydrogens of the dechlorinated product were in meta positions. Therefore, the above-described analysis demonstrated that the 6-chlorine but not the 3-chlorine of 3,6-DCGA was replaced by a hydrogen, generating 3-chlorogentisate.

FIG 4
  • Open in new tab
  • Download powerpoint
FIG 4

1H NMR analysis of the dechlorinated product of 3,6-DCGA transformed by DsmH2. (A) 1H NMR spectrum of 3,6-DCGA. (B) 1H NMR spectrum of the dechlorinated product.

Biochemical properties of DsmH1 and DsmH2.Neither DsmH1 nor DsmH2 displayed 3,6-DCGA dehalogenase activity in the absence of GSH, indicating that they are GSH dependent. The specific activities of DsmH1 and DsmH2 were 0.06 ± 0.01 and 23.24 ± 2.73 U mg−1 (Table 2), respectively, indicating that the catalytic efficiency of DsmH2 toward 3,6-DCGA was significantly higher than that of DsmH1. The Km and Kcat/Km values of DsmH2 for 3,6-DCGA were 23.59 ± 1.46 μM and 16.30 ± 3.93 μM−1 min−1, respectively (Fig. S3A and Table 2). However, like PcpC (26), the kinetics of DsmH1 did not fit the Michaelis-Menten equation (Fig. S3B). In addition to 3,6-DCGA, DsmH1 could also catalyze the successive dechlorination of TCHQ and 2,5-DCHQ but not that of p-nitrobenzyl chloride; 3-, 4-, 5-, or 6-chlorosalicylate; 3,5-DCSA; 3,6-DCSA; 3-, 4-, or 6-chlorogentisate; 3-chloro-4-hydroxybenzoate; 4-chlorobenzoate; 2-chlorohydroquinone; 3,5-dichloro-4-hydroxybenzoate; or 1-chloro-2,4-dinitrobenzene (Table S1). In contrast, DsmH2 could not transform other chloro-substituted aromatic compounds tested in this study, with the exception of 3,6-DCGA and 6-chlorogentisate, indicating that DsmH2 has a relatively narrower substrate spectrum than DsmH1.

View this table:
  • View inline
  • View popup
TABLE 2

Comparison of the kinetic properties of DsmH1 and DsmH2

Both DsmH1 and DsmH2 exhibited the highest catalytic activity at pH 7.4 in 50 mM Tris-HCl (Fig. S4). The optimum temperatures for purified DsmH1 and DsmH2 were 25°C and 30°C, respectively (Fig. S5). The effects of metal ions and potential enzyme inhibitors on DsmH1 and DsmH2 activity are shown in Fig. S6. DsmH1 and DsmH2 activities were severely inhibited by 1.0 mM Hg2+, Cd2+, Zn2+, and Ag2+ and 5 mM SDS and were moderately inhibited by 1.0 mM Mn2+, Ni2+, Al3+, and Co2+ and 5.0 mM C2H2INaO2.

Transcriptional analysis.The reverse transcription (RT)-PCR results showed that dsmH2 was transcribed in cells grown with glucose, 3,6-DCSA, and 3,6-DCGA, but the level was apparently enhanced by 3,6-DCSA and 3,6-DCGA; in contrast, dsmH1 was not transcribed at all under the same conditions (Fig. S7). RT-quantitative PCR (RT-qPCR) showed that the transcription levels of dsmH2 in 3,6-DCSA- and 3,6-DCGA-cultured cells were enhanced by 12-fold and 22-fold, respectively, compared with those in glucose-cultured cells (data not shown). Therefore, transcriptional analysis indicated that dsmH2 but not dsmH1 is involved in the dechlorination of 3,6-DCGA.

Disruption of the dsmH1 and dsmH2 genes and phenotypic analysis.To further investigate the roles of the two GSTs in the catabolism of 3,6-DCGA in strain Ndbn-20, the genes dsmH1 and dsmH2 were separately disrupted by homologous recombination. Two mutants, Ndbn-20 ΔdsmH1 and Ndbn-20 ΔdsmH2, were generated. The whole-cell transformation results showed that mutant Ndbn-20 ΔdsmH2 lost the ability to degrade 3,6-DCGA, whereas mutant Ndbn-20 ΔdsmH1 could still degrade 3,6-DCGA, and there was no significant difference between the 3,6-DCGA degradation rates of mutant Ndbn-20 ΔdsmH1 and wild-type strain Ndbn-20 (Fig. S8A). The results further demonstrated that dsmH2 but not dsmH1 was physiologically responsible for the degradation of 3,6-DCGA in strain Ndbn-20.

The dicamba degradation rates of the two mutants were also investigated. The results showed that both strain Ndbn-20 and mutant Ndbn-20 ΔdsmH1 could rapidly degrade dicamba, and there was no notable accumulation of metabolite during the degradation process (Fig. S8B). The mutant Ndbn-20 ΔdsmH2 could also degrade dicamba, but its degradation rate was much lower than the degradation rates of strain Ndbn-20 and mutant Ndbn-20 ΔdsmH1. After incubation for 36 h, approximately 0.63 mM dicamba was transformed by mutant Ndbn-20 ΔdsmH2 and approximately 0.51 mM 3,6-DCGA was accumulated, which was not further transformed, despite the prolonged incubation. These results provide further evidence that dsmH2 but not dsmH1 is involved in the catabolism of dicamba and 3,6-DCGA in R. dicambivorans Ndbn-20.

DISCUSSION

Dicamba is demethylated to 3,6-DCSA, which is then 5-hydroxylated to 3,6-DCGA in strain Ndbn-20 (8). Generally, halogenated compounds are recalcitrant due to the electronegativity increase caused by the halogen substituent. Thus, dechlorination is the initial and key step in the catabolism of halogenated compounds (27). In this study, we demonstrated that strain Ndbn-20 could 6-dechlorinate 3,6-DCGA to 3-chlorogentisate. Interestingly, strain Ndbn-20 harbored two GSH-dependent 3,6-DCGA dehalogenase genes, dsmH1 and dsmH2. However, dsmH1 was not transcribed in cells grown with glucose, 3,6-DCSA, or 3,6-DCGA, whereas the transcription of dsmH2 was markedly enhanced by 3,6-DCSA and 3,6-DCGA; moreover, the disruption of dsmH1 had no effect on 3,6-DCGA degradation, while the disruption of dsmH2 resulted in the inability to degrade 3,6-DCGA. These results show that DsmH2 but not DsmH1 is physiologically responsible for 3,6-DCGA dechlorination in R. dicambivorans Ndbn-20.

Enzymatic assay showed that DsmH2 could catalyze the dechlorination of 3,6-DCGA and 6-chlorogentisate but not that of 3-, 4-, or 5-chlorosalicylate or 3- or 4-chlorogentisate. 1H NMR analysis also demonstrated that the dechlorination of 3,6-DCGA occurred at the C-6 but not the C-3 position of 3,6-DCGA. These results revealed that the DsmH2-catalyzed dechlorination is position specific and that only the 6-chlorine can be removed. However, the 6-chlorine of 3,6-DCSA and 6-chlorosalicylate could not be eliminated by DsmH2. One possible reason may be that the DsmH2-catalyzed dechlorination requires the substrate to have two para-positioned hydroxyl groups and 3,6-DCSA and 6-chlorosalicylate have only one hydroxyl group. Similar phenomena have also been observed for PcpC (its substrates are TCHQ and TriCHQ but not pentachlorophenol or tetrachlorophenol) and LinD (its substrates are 2,5-DCHQ and CHQ but not 2,5-dichlorophenol) (28, 29).

GSTs are some of nature's most versatile enzymes. They catalyze the conjugation of GSH to a wide range of toxic hydrophobic endo- and xenobiotics for detoxification or degradation (30, 31). GSTs are widely distributed in both eukaryotes and prokaryotes and consist of three major superfamilies, namely, cytosolic GSTs, mitochondrial GSTs, and microsomal GSTs (30, 32). Cytosolic GSTs represent the largest superfamily of GSTs and are divided into at least 15 classes: alpha, beta, chi, delta, epsilon, lambda, mu, omega, phi, pi, rho, sigma, tau, theta, and zeta (32, 33). In bacteria, only four kinds of cytosolic GSTs (beta, chi, theta, and zeta) have been reported (30, 33, 34). The present study showed that both DsmH1 and DsmH2 are most closely related to GSTs and require GSH as a cofactor. Therefore, they were classified as the GSTs. DsmH1 and DsmH2 shared a close relationship with PcpC. Physiologically, PcpC catalyzes two successive dehalogenation reactions and removes two chlorines (at the 3 and 6 positions) from TCHQ to form DCHQ in Sphingobium chlorophenolicum ATCC 39723 (20, 22). The dehalogenase activity of PcpC is severely inhibited by the substrates TCHQ and TriCHQ (26, 28, 29). DsmH1 shared a high identity (79%) and clustered tightly with PcpC in the phylogenetic tree constructed on the basis of related GSTs (Fig. 5). Furthermore, DsmH1 shared similar enzymatic characteristics with PcpC; e.g., they catalyze the successive dechlorination of TCHQ. Thus, DsmH1 possibly functions as a TCHQ dehalogenase. In contrast, DsmH2 shared a very low identity with PcpC (31%) and LinD (26%), and in the phylogenetic tree, DsmH2 was clustered with PcpC, DsmH1, and LinD but formed a separate subclade. Enzymatic analysis showed that DsmH2 could not transform TCHQ or 2,5-DCHQ. Furthermore, the dehalogenase activity of DsmH2 was not inhibited by its substrate, 3,6-DCGA, which was different from the findings for PcpC. Therefore, the results of the phylogenetic analysis and enzymatic characteristics indicated that DsmH2 is a novel GSH-dependent dehalogenase.

FIG 5
  • Open in new tab
  • Download powerpoint
FIG 5

Phylogenetic tree constructed on the basis of the alignment of DsmH1, DsmH2, and related GSTs. The multiple-sequence alignment analysis was performed with the MAFFT algorithm, and the phylogenetic tree was constructed by the neighbor-joining (NJ) method using the MEGA (v7.0) program. Bootstrap values (based on 1,000 replications) are indicated at branch nodes. Bar, 0.20 substitution per nucleotide position. Each item is arranged in the following order: protein source and GST class (GenBank accession number).

The dehalogenases PcpC and LinD were previously classified as zeta-class GSTs because they share sequence similarities with zeta-class GSTs and contain the conserved motif of zeta-class GSTs (31). Zeta was established as a class of GSTs by Board et al. in 1997 (35). Zeta-class proteins are widely present in a range of eukaryotic species, including fungi, plants, mammals, and humans (34, 36, 37). The first reported zeta GST was a maleylacetoacetate isomerase (MAAI) that catalyzed the isomerization of maleylacetoacetate (MAA) to fumarylacetoacetate (35, 38). Zeta-class proteins have a conserved motif (LYSYWR/LSSCSXR/KVRIAL) that includes two active-site residues: a serine, stabilizing the thiolate of glutathione (39), and a cysteine, acting as a nucleophile (34, 35, 38). In this study, we observed that PcpC and LinD, together with DsmH1 and DsmH2, were distinct from zeta-class GSTs based on the following evidences: (i) PcpC, LinD, DsmH1, and DsmH2 are present in bacteria, while zeta-class GSTs are present in eukaryotes. Furthermore, the four bacterial dehalogenases share very low sequence identity (less than 20%) with eukaryotic zeta-class GSTs, and it is generally accepted that GSTs that share less than 25% identity should be assigned to separate classes (40). (ii) In the phylogenetic tree of the reported GSTs, the four bacterial dehalogenases form a distinct clade that is far away from the eukaryotic zeta-class GSTs (Fig. 5). (iii) The four dehalogenases catalyze the dechlorination of polychlorinated aromatics, whereas eukaryotic zeta-class GSTs catalyze the isomerization of MAA. (iv) Although the N-terminal regions of the four bacterial dehalogenases have the conserved motif of eukaryotic zeta-class proteins, the C-terminal regions of the bacterial dehalogenases share very low sequence identity with each other and with eukaryotic zeta-class GSTs. Furthermore, two regions (amino acid residues 120 to 140 and 175 to 180 of DsmH2) of bacterial dehalogenases are absent in eukaryotic zeta-class GSTs (Fig. 6). The diversity and low identity of the C-terminal regions may be due to their different functions. The N-terminal region of bacterial dehalogenases and zeta-class GSTs is primarily responsible for binding and activating GSH, whereas the C-terminal region is generally responsible for binding the electrophilic substrate (28, 33, 35). Thus, both dehalogenases and isomerases have similar N-terminal regions to bind and activate GSH and diverse C-terminal regions to bind different substrates. Therefore, based on the above-described analysis, we propose that the four bacterial dehalogenases be classified as a novel eta class of GSTs.

FIG 6
  • Open in new tab
  • Download powerpoint
FIG 6

Sequence alignment of DsmH1 and DsmH2 with related GSTs. The GenBank accession number of each sequence is as follows: Q03520 for PcpC (Sphingobium chlorophenolicum), P95806.1 for LinD (Sphingomonas paucimobilis), O43708.3 for human (Homo sapiens) zeta GST, Q9WVL0.1 for mouse (Mus musculus) zeta GST, P28342.1 for carnation (Dianthus caryophyllus) zeta GST, AAO60042.1 for rape (Brassica napus) zeta GST, AAO60039.1 for arabidopsis (Arabidopsis thaliana) zeta GST, P57108.1 for weed (Euphorbia esula) zeta GST, and AFD36889.1 for insect (Panonychus citri) zeta GST. Numbers above the amino acid sequences indicate the residue position in DsmH2. The predicted DsmH2 secondary structure is shown above the alignment with α-helices, β-strands, and turns. Conserved amino acids are shown in boxes (red text), and identical amino acids are shown with a red background. Two active-site residues, serine and cysteine, are indicated by arrowheads, and two regions (positions 120 to 140 and 175 to 180 of DsmH2) are indicated by violet rectangles.

dsmH2 is located in a gene cluster that contains three other genes, including a gentisate 1,2-dioxygenase gene (gtdA), a fumarylpyruvate hydrolase gene, and a glutathione reductase gene. The four genes are orientated in the same direction, and a putative promoter (GGTTATTCGAACCATGCCTCATTGTAGAATAAATTTCATATTGCGCAATA) and a Shine-Dalgarno sequence (GGAGG) are located 87 bp and 4 bp upstream of the start codon (ATG) of gtdA, respectively, indicating that the four genes constitute an operon. Glutathione reductase catalyzes the reduction of glutathione disulfide (GSSG) to GSH (7); thus, its role is predicted to regenerate the GSH consumed during the 3,6-DCGA dichlorination by DsmH2 (Fig. 2B). GtdA can cleave gentisate, 3,6-DCGA (7, 41, 42), and 3-chlorogentisate (our unpublished data) in vitro. However, this study showed that when dsmH2 is disrupted (while gtdA is complete), the Ndbn-20 ΔdsmH2 mutant could not degrade 3,6-DCGA, and our unpublished data indicated that the Ndbn-20 ΔdsmH2 mutant could still degrade 3-chlorogentisate and gentisate. These results suggest that the in vivo role of GtdA in strain Ndbn-20 is to cleave 3-chlorogentisate, which was dechlorinated from 3,6-DCGA, which was catalyzed by DsmH2 (Fig. 2B).

MATERIALS AND METHODS

Chemicals and media.GSH, 3,6-DCSA, salicylate, gentisate, and other aromatic substrates were obtained from Molbase; 3,6-DCGA was purified as described in our previous study (8). All the chemicals were of >98% purity. Luria-Bertani (LB) medium contained (liter−1) 10.0 g tryptone, 5.0 g yeast extract, and 8.0 g NaCl, pH 7.0; 1/5 LB broth was prepared by diluting LB broth with 4-fold distilled water. Minimal salts medium (MSM) contained (liter−1) 1.3 g K2HPO4, 0.86 g KH2PO4, 0.66 g (NH4)2SO4, 0.097 g MgSO4, 0.025 g MnSO4·H2O, 0.005 g FeSO4·7H2O, and 0.0013 g CaSO4·6H2O, pH 7.0.

Bacterial strains, plasmids, and culture conditions.The bacterial strains and plasmids used in this study are listed in Table 3, and the primers used are described in Table 4. R. dicambivorans Ndbn-20 and its derivatives were grown aerobically at 30°C in 1/5 LB broth, while the E. coli strains were routinely grown aerobically at 37°C in LB broth. When needed, antibiotics were used at the following concentrations: 100 μg ml−1 ampicillin, 100 μg ml−1 streptomycin, 50 μg ml−1 kanamycin, 30 μg ml−1 chloramphenicol, or 15 μg ml−1 gentamicin.

View this table:
  • View inline
  • View popup
TABLE 3

Strains and plasmids used in this study

View this table:
  • View inline
  • View popup
TABLE 4

PCR primers used in this study

Preparation of cell lysate.Mutant and wild-type strains of R. dicambivorans Ndbn-20 were cultivated in appropriate volumes of 1/5 LB broth to the exponential phase at 30°C in a shaking incubator at 180 rpm. Cells were harvested by centrifugation at 2,600 × g (Beckman [USA] Allegra X-22R) and 4°C for 15 min. Next, the cells were washed twice and diluted to an optical density at 600 nm of 1.0 with liquid MSM prior to the addition of 0.5 mM 3,6-DCSA; the cells were then aerobically incubated at 30°C and recollected when approximately 60% of the added 3,6-DCSA was degraded. The pellets were washed, suspended with ice-cold phosphate-buffered saline (PBS) buffer (50 mM, pH 7.4), and then disrupted by sonication. The cell supernatant was collected by centrifugation at 13,000 × g and 4°C for 30 min. The supernatant was obtained as the cell lysate.

Enzyme activity analysis of the cell lysate.For enzyme assays, 100 μl cell lysate was added to 900 μl PBS buffer containing 1.0 mM NADH, NADPH, ATP, or GSH. The reaction was initiated by the addition of 3,6-DCGA. The enzyme mixture was incubated at 30°C for 30 min. High-performance liquid chromatography (HPLC) and UV absorption were used to monitor the product appearance and substrate disappearance, and UHPLC/MS was used to identify the product.

Analytical methods.For HPLC, UV absorption, and UHPLC/MS analysis, the samples were acidified to pH 2.0 with 0.5% HCl and extracted twice with ethyl acetate. Next, the ethyl acetate solvent was removed by a stream of nitrogen gas and the sample was redissolved in methanol and filtered through a 0.22-μm-pore-size Millipore membrane. HPLC was performed on an UltiMate 3000 Titanium system (Thermo Fisher Scientific) equipped with a C18 reversed-phase column (4.6 by 250 mm; particle size, 5 μm; Agilent Technologies). The mobile phase was methanol-water-acetic acid-phosphoric acid at a ratio of 70:30:0.3:0.2 (vol/vol/vol/vol) with a flow rate of 0.8 ml min−1. The column temperature was set at 30°C, and the injection volume was 20 μl. A VWD-3100 single-wavelength detector was used to monitor the UV absorption; the detection wavelengths were 319 nm for 3,6-DCSA and 330 nm for gentisate derivatives. For qualitative analysis, the UV absorption of the sample was detected by a UV scanner (UV-2450; Shimadzu, Japan) at wavelengths of from 200 to 400 nm. The UHPLC/MS analysis was performed on a Hypersil Gold C18 column (100 mm by 2.10 mm; particle size, 3 μm; Thermo Fisher Scientific), and the mobile phase consisted of solvents A (0.1% formic acid in water) and B (acetonitrile) with a gradient program starting with 90% solvent A from 0 to 2 min, followed by a decrease to 10% solvent A from 2 to 14 min, a hold at 10% solvent A from 14 to 16 min, and then a return to 90% solvent A for 0.1 min and equilibration for 3.9 min. The flow rate was 0.4 ml min−1. Mass spectrometric analysis was performed using an LTQ Orbitrap XL mass spectrometer (Thermo Fisher Scientific) equipped with an electrospray ionization (ESI) probe. The metabolites were ionized by electrospray with negative polarity, and the results were analyzed with MassLynx (v4.1) software.

Bioinformatics analysis.Multiple-sequence alignment was performed with ClustalX (v2.1) software (43) and visualized with ESPript (v3) software (44). DNA and amino acid sequence identity searches were conducted using the BLASTN and BLASTP tools (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and the Swiss-Prot databases. Evolutionary analysis was carried out using the MEGA (v7.0) program (45). The phylogenetic tree was generated by the use of neighbor-joining algorithms, Kimura's two-parameter model was used to calculate the distances, and the bootstrap value was set at 1,000 replications for analysis.

Expression of the three putative dehalogenase genes and determination of their 3,6-DCGA dehalogenase activities.The sequences encoding the three putative dehalogenase genes were amplified from the genomic DNA of strain Ndbn-20 with the primers listed in Table 4 using PrimeSTAR GXL DNA polymerase. The expression plasmids pET24b(+)-ORF03780, pET24b(+)-ORF14585, and pET24b(+)-ORF18325 were constructed by fusing ORF03780, ORF14585, and ORF18325, respectively, to the NdeI-XhoI site of the expression vector pET24b(+) using a one-step cloning kit (Vazyme Biotech, Nanjing, China). These recombinant plasmids were individually introduced into E. coli BL21(DE3). The transformants were grown in 100 ml of LB medium at 37°C. When the absorbance at 600 nm reached 0.5, the cultures were induced with 0.2 mM isopropyl-β-d-thiogalactopyranoside (IPTG) for 10 h at 16°C. Next, cells were harvested, resuspended in ice-cold PBS buffer (50 mM, pH 7.4), and then disrupted by sonication. After centrifugation (13,000 × g for 30 min at 4°C), the supernatants were obtained as crude extracts. The C-terminal His6-tagged proteins were purified from the crude extracts using a 1-cm3 Co2+-charged resin column (HiTrap Talon crude; GE Healthcare Life Sciences) according to the method described by Chu et al. in 2017 (46). The resultant fractions were dialyzed overnight at 4°C to remove imidazole in PBS buffer (50 mM, pH 7.4) supplemented with 0.1 mM dithiothreitol. The proteins were concentrated by ultrafiltration using a 3,000-molecular-weight-cutoff (MWCO) centrifugal filter (Merck Millipore, Germany). The purities and molecular weights of the purified proteins were determined using 12% SDS-PAGE gels. The protein concentrations were determined by the Bradford method with bovine serum albumin as the standard (47).

Enzyme activity assays.The activities of the purified proteins were determined in a 1.0-ml reaction mixture containing 50 mM PBS buffer, 0.1 mM 3,6-DCGA, 1.0 mM GSH, and an appropriate amount of enzyme. The reaction was initiated by adding 3,6-DCGA to the enzyme mixtures. A reaction mixture without the purified protein was used as a control. The enzyme activity was immediately qualitatively estimated using a UV scanning method and subsequently quantitatively determined by HPLC, and the products were identified by UHPLC/MS as described above. The Michaelis-Menten kinetics were determined by plotting reaction rates against nine concentrations of 3,6-DCGA (5 to 80 mg liter−1) from three independent sets of experiments with the GSH concentration fixed at 1.0 mM. Data were fitted to the Michaelis-Menten equation by OriginPro (v8) software (OriginLab, Northampton, MA). Kinetic parameters were obtained by nonlinear regression analysis via the Michaelis-Menten equation. One unit of enzyme activity was defined as the amount of enzyme required to catalyze 1.00 μmol 3,6-DCGA per minute.

The optimal pH range was determined at pH values ranging from 3.0 to 8.8, with the activity observed at pH 7.4 in PBS buffer being set as 100%; three buffers were used: 50 mM citric acid buffer (pH 3.0 to 6.0), 50 mM PBS buffer (pH 6.0 to 8.0), and 50 mM Tris-HCl buffer (pH 7.0 to 8.8). The optimal temperature range of the enzymes was assayed from 4 to 55°C, and the relative activity was calculated by assuming that the activity at 30°C was 100%. To investigate the effects of potential inhibitors on dehalogenase activity, various chemical agents (EDTA, SDS, urea, phenylmethylsulfonyl fluoride, and C2H2INaO2; final concentrations, 5.0 mM) and metal ions (Li+, Na+, Mg2+, Hg2+, Mn2+, Ni2+, Co2+, Ca2+, Zn2+, Cr2+, Ba2+, Al3+, Cd2+, and Ag+; final concentrations, 1.0 mM) were individually added, and the reactions were performed at 25°C for 30 min.

Determination of the dehalogenation position in 3,6-DCGA by NMR.To confirm which chlorine atom of 3,6-DCGA was reduced, the dechlorinated product was extracted from the enzymatic reaction mixture by ethyl acetate. The reaction mixture consisted of excess purified DsmH2 and GSH, and the reaction was allowed to proceed until the added 3,6-DCGA was completely converted to the dechlorinated product. The dechlorinated product was purified using silica gel column chromatography (3 by 40 cm); the mobile phase was ethyl acetate-chloroform-formic acid at a 10:6:1 ratio, and the eluate was collected in 10-ml fractions. After being confirmed by HPLC and MS-MS analysis, the purified product was dissolved in dimethyl sulfoxide-d6 (DMSO-d6) in a 5-mm NMR tube, and its 1H NMR spectra were acquired at 500 MHz on a Bruker AvanceIII spectrometer. The results were analyzed using Bruker TopSpin (v3.1) software. Chemical shifts are reported in delta (δ) units, in parts per million downfield from tetramethylsilane (TMS), or in parts per million relative to the center of the singlet at 2.50 ppm for DMSO-d6. J values are reported in hertz, and the splitting patterns were designated d (doublet).

RNA preparation and transcription analysis.Cells of strain Ndbn-20 were cultivated using 0.5 mM 3,6-DCSA, 3,6-DCGA, or glucose as the sole carbon source for growth as previously described (8). The cells were harvested until approximately 50% of the added 3,6-DCSA or 3,6-DCGA was transformed. Total RNA was extracted from the cells using a MiniBEST universal RNA extraction kit (TaKaRa, Dalian, China). The RNA was treated by incubation with gDNA Eraser (TaKaRa) at 42°C for 2 min to remove any genomic DNA contamination. Reverse transcription was carried out with a PrimeScript reverse transcriptase kit (TaKaRa), and RT-PCR was carried out with the primers listed in Table 4. RT-qPCR was performed with a SYBR Premix Ex Taq RT-PCR kit (Tli RNaseHPlus; TaKaRa) in an Applied Biosystems 7300 real-time PCR system (Applied Biosystems, USA) with the primers listed in Table 4. A 142-bp fragment of the 16S rRNA gene of strain Ndbn-20 was used as the reference to evaluate the relative differences in integrity between individual RNA samples. All samples were run in triplicate. The 2−ΔΔCT threshold cycle (CT) method was used to calculate relative expression (48).

Disruption of dsmH1 and dsmH2 in R. dicambivorans Ndbn-20 by homologous recombination.pJQ200SKdsmH1 and pJQ200SKdsmH2 were constructed by fusing the middle fragment of the target gene (dsmH1 or dsmH2) to the PstI- and BamHI-digested suicide plasmid pJQ200SK (49) using an In-Fusion HD cloning kit (TaKaRa, Dalian, China). The primers used are listed in Table 4. The recombinant plasmids were then transformed into E. coli DH5α before conjugation with strain Ndbn-20 as described previously (8). The candidate mutants were screened on 1/5 LB agar containing 100 μg ml−1 streptomycin and 15 μg ml−1 gentamicin. The ability of the mutants to degrade dicamba or 3,6-DCGA was determined through a whole-cell biotransformation test in liquid MSM as described by Wang et al. (50); the concentrations of dicamba and 3,6-DCGA supplemented into MSM were 1.0 mM and 0.5 mM, respectively. The concentrations of the substrate and intermediate were determined by HPLC as described above.

Accession number(s).The sequences of dsmH1 and dsmH2 have been submitted to GenBank under accession numbers MG878876 and MG878877, respectively. The chromosomal genome of R. dicambivorans Ndbn-20 and the plasmids P1, P2, P3, and P4 have been deposited in the GenBank database under accession numbers CP023449, CP023450, CP023451, CP023452, and CP023453, respectively.

ACKNOWLEDGMENTS

This work was supported by the National Key R&D Program of China (2016YFD0801102), the National Natural Science Foundation of China (no. 31570105, 31700096, and 31500082) and the Science and Technology Project of Jiangsu Province (BE2016374).

FOOTNOTES

    • Received 16 March 2018.
    • Accepted 18 June 2018.
    • Accepted manuscript posted online 22 June 2018.
  • Address correspondence to Jian He, hejian{at}njau.edu.cn.
  • Citation Li N, Tong R-L, Yao L, Chen Q, Yan X, Ding D-R, Qiu J-G, He J, Jiang J-D. 2018. Roles of two glutathione-dependent 3,6-dichlorogentisate dehalogenases in Rhizorhabdus dicambivorans Ndbn-20 in the catabolism of the herbicide dicamba. Appl Environ Microbiol 84:e00623-18. https://doi.org/10.1128/AEM.00623-18.

  • Supplemental material for this article may be found at https://doi.org/10.1128/AEM.00623-18.

REFERENCES

  1. 1.↵
    1. Tomlin CDS
    . 2006. The pesticide manual: a world compendium, 14th ed. British Crop Protection Council, Farnham, Surrey, United Kingdom.
  2. 2.↵
    1. Huang X,
    2. He J,
    3. Yan X,
    4. Hong Q,
    5. Chen K,
    6. He Q,
    7. Zhang L,
    8. Liu XW,
    9. Chuang SC,
    10. Li SP
    . 2017. Microbial catabolism of chemical herbicides: microbial resources, metabolic pathways and catabolic genes. Pestic Biochem Physiol 143:272–297. doi:10.1016/j.pestbp.2016.11.010.
    OpenUrlCrossRef
  3. 3.↵
    1. Behrens MR,
    2. Mutlu N,
    3. Chakraborty S,
    4. Dumitru R,
    5. Jiang WZ,
    6. LaVallee BJ,
    7. Herman PL,
    8. Clemente TE,
    9. Weeks DP
    . 2007. Dicamba resistance: enlarging and preserving biotechnology-based weed management strategies. Science 316:1185–1188. doi:10.1126/science.1141596.
    OpenUrlAbstract/FREE Full Text
  4. 4.↵
    1. Wang XZ,
    2. Li B,
    3. Herman PL,
    4. Weeks DP
    . 1997. A three-component enzyme system catalyzes the O-demethylation of the herbicide dicamba in Pseudomonas maltophilia DI-6. Appl Environ Microbiol 63:1623–1626.
    OpenUrlAbstract/FREE Full Text
  5. 5.↵
    1. Yao L,
    2. Yu LL,
    3. Zhang JJ,
    4. Xie XT,
    5. Tao Q,
    6. Yan X,
    7. Hong Q,
    8. Qiu JG,
    9. He J,
    10. Ding DR
    . 2016. A tetrahydrofolate-dependent methyltransferase catalyzing the demethylation of dicamba in Sphingomonas sp. strain Ndbn-20. Appl Environ Microbiol 82:5621–5630. doi:10.1128/AEM.01201-16.
    OpenUrlAbstract/FREE Full Text
  6. 6.↵
    1. Yao L,
    2. Jia XJ,
    3. Zhao JD,
    4. Cao Q,
    5. Xie XT,
    6. Yu LL,
    7. He J,
    8. Tao Q
    . 2015. Degradation of the herbicide dicamba by two sphingomonads via different O-demethylation mechanisms. Int Biodeterior Biodegr 104:324–332. doi:10.1016/j.ibiod.2015.06.016.
    OpenUrlCrossRef
  7. 7.↵
    1. Werwath J,
    2. Arfmann HA,
    3. Pieper DH,
    4. Timmis KN,
    5. Wittich RM
    . 1998. Biochemical and genetic characterization of a gentisate 1,2-dioxygenase from Sphingomonas sp. strain RW5. J Bacteriol 180:4171–4176.
    OpenUrlAbstract/FREE Full Text
  8. 8.↵
    1. Li N,
    2. Yao L,
    3. He Q,
    4. Qiu JG,
    5. Cheng D,
    6. Ding DR,
    7. Tao Q,
    8. He J,
    9. Jiang JD
    . 2018. The catabolism of 3,6-dichlorosalicylate is initiated by the cytochrome P450 monooxygenase system DsmABC in Rhizorhabdus dicambivorans Ndbn-20. Appl Environ Microbiol 84:e02133-17. doi:10.1128/AEM.02133-17.
    OpenUrlCrossRef
  9. 9.↵
    1. Janssen DB,
    2. Oppentocht JE,
    3. Poelarends GJ
    . 2001. Microbial dehalogenation. Curr Opin Biotechnol 12:254–258. doi:10.1016/S0958-1669(00)00208-1.
    OpenUrlCrossRefPubMedWeb of Science
  10. 10.↵
    1. Wang GL,
    2. Li R,
    3. Li SP,
    4. Jiang JD
    . 2010. A novel hydrolytic dehalogenase for the chlorinated aromatic compound chlorothalonil. J Bacteriol 192:2737–2745. doi:10.1128/JB.01547-09.
    OpenUrlAbstract/FREE Full Text
  11. 11.↵
    1. Wu JF,
    2. Jiang CY,
    3. Wang BJ,
    4. Ma YF,
    5. Liu ZP,
    6. Liu SJ
    . 2006. Novel partial reductive pathway for 4-chloronitrobenzene and nitrobenzene degradation in Comamonas sp. strain CNB-1. Appl Environ Microbiol 72:1759–1765. doi:10.1128/AEM.72.3.1759-1765.2006.
    OpenUrlAbstract/FREE Full Text
  12. 12.↵
    1. Min J,
    2. Zhang JJ,
    3. Zhou NY
    . 2015. A two-component para-nitrophenol monooxygenase initiates a novel 2-chloro-4-nitrophenol catabolic pathway in Rhodococcus imtechensis RKJ300. Appl Environ Microbiol 82:714–723. doi:10.1128/AEM.03042-15.
    OpenUrlAbstract/FREE Full Text
  13. 13.↵
    1. Gao YZ,
    2. Liu H,
    3. Chao HJ,
    4. Zhou NY
    . 2016. Constitutive expression of nag-like dioxygenase gene through an internal promoter in the 2-chloronitrobenzene catabolic gene cluster of Pseudomonas stutzeri ZWLR2-1. Appl Environ Microbiol 82:3461–3470. doi:10.1128/AEM.00197-16.
    OpenUrlAbstract/FREE Full Text
  14. 14.↵
    1. Jong RMD,
    2. Dijkstra BW
    . 2003. Structure and mechanism of bacterial dehalogenases: different ways to cleave a carbon-halogen bond. Curr Opin Struct Biol 13:722–730. doi:10.1016/j.sbi.2003.10.009.
    OpenUrlCrossRefPubMed
  15. 15.↵
    1. Liu H,
    2. Wang SJ,
    3. Zhang JJ,
    4. Dai H,
    5. Tang H,
    6. Zhou NY
    . 2011. Patchwork assembly of nag-like nitroarene dioxygenase genes and the 3-chlorocatechol degradation cluster for evolution of the 2-chloronitrobenzene catabolism pathway in Pseudomonas stutzeri ZWLR2-1. Appl Environ Microbiol 77:4547–4552. doi:10.1128/AEM.02543-10.
    OpenUrlAbstract/FREE Full Text
  16. 16.↵
    1. Ma YF,
    2. Wu JF,
    3. Wang SY,
    4. Jiang CY,
    5. Zhang Y,
    6. Qi SW,
    7. Liu L,
    8. Zhao GP,
    9. Liu SJ
    . 2007. Nucleotide sequence of plasmid pCNB1 from Comamonas strain CNB-1 reveals novel genetic organization and evolution for 4-chloronitrobenzene degradation. Appl Environ Microbiol 73:4477–4483. doi:10.1128/AEM.00616-07.
    OpenUrlAbstract/FREE Full Text
  17. 17.↵
    1. Van Pée KH,
    2. Unversucht S
    . 2003. Biological dehalogenation and halogenation reactions. Chemosphere 52:299–312. doi:10.1016/S0045-6535(03)00204-2.
    OpenUrlCrossRefPubMedWeb of Science
  18. 18.↵
    1. Adrian L,
    2. Rahnenführer J,
    3. Gobom J,
    4. Hölscher T
    . 2007. Identification of a chlorobenzene reductive dehalogenase in Dehalococcoides sp. strain CBDB1. Appl Environ Microbiol 73:7717–7724. doi:10.1128/AEM.01649-07.
    OpenUrlAbstract/FREE Full Text
  19. 19.↵
    1. Payne KA,
    2. Quezada CP,
    3. Fisher K,
    4. Dunstan MS,
    5. Collins FA,
    6. Sjuts H,
    7. Levy C,
    8. Hay S,
    9. Rigby SE,
    10. Leys D
    . 2015. Reductive dehalogenase structure suggests a mechanism for B12-dependent dehalogenation. Nature 517:513–516. doi:10.1038/nature13901.
    OpenUrlCrossRefPubMed
  20. 20.↵
    1. Xun LY,
    2. Topp E,
    3. Orser CS
    . 1992. Purification and characterization of a tetrachloro-p-hydroquinone reductive dehalogenase from a Flavobacterium sp. J Bacteriol 174:8003–8007. doi:10.1128/jb.174.24.8003-8007.1992.
    OpenUrlAbstract/FREE Full Text
  21. 21.↵
    1. Fortin PD,
    2. Horsman GP,
    3. Yang HM,
    4. Eltis LD
    . 2006. A glutathione S-transferase catalyzes the dehalogenation of inhibitory metabolites of polychlorinated biphenyls. J Bacteriol 188:4424–4430. doi:10.1128/JB.01849-05.
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    1. Orser CS,
    2. Dutton J,
    3. Lange C,
    4. Jablonski P,
    5. Xun LY,
    6. Hargis M
    . 1993. Characterization of a Flavobacterium glutathione S-transferase gene involved reductive dechlorination. J Bacteriol 175:2640–2644. doi:10.1128/jb.175.9.2640-2644.1993.
    OpenUrlAbstract/FREE Full Text
  23. 23.↵
    1. Miyauchi K,
    2. Suh SK,
    3. Nagata Y,
    4. Takagi M
    . 1998. Cloning and sequencing of a 2,5-dichlorohydroquinone reductive dehalogenase gene whose product is involved in degradation of γ-hexachlorocyclohexane by Sphingomonas paucimobilis. J Bacteriol 180:1354–1359.
    OpenUrlAbstract/FREE Full Text
  24. 24.↵
    1. Masai E,
    2. Ichimura A,
    3. Sato Y,
    4. Miyauchi K,
    5. Katayama Y,
    6. Fukuda M
    . 2003. Roles of the enantioselective glutathione S-transferases in cleavage of beta-aryl ether. J Bacteriol 185:1768–1775. doi:10.1128/JB.185.6.1768-1775.2003.
    OpenUrlAbstract/FREE Full Text
  25. 25.↵
    1. Simons WW
    . 1978. The Sadtler handbook of proton NMR spectra. Sadtler Research Laboratories, Philadelphia, PA.
  26. 26.↵
    1. Warner JR,
    2. Behlen LS,
    3. Copley SD
    . 2008. A trade-off between catalytic power and substrate inhibition in TCHQ dehalogenase. Biochemistry 47:3258–3265. doi:10.1021/bi702431n.
    OpenUrlCrossRefPubMedWeb of Science
  27. 27.↵
    1. Fetzner S,
    2. Lingens F
    . 1994. Bacterial dehalogenases: biochemistry, genetics, and biotechnological applications. Microbiol Rev 58:641–685.
    OpenUrlAbstract/FREE Full Text
  28. 28.↵
    1. Kiefer PM, Jr,
    2. Copley SD
    . 2002. Characterization of the initial steps in the reductive dehalogenation catalyzed by tetrachlorohydroquinone dehalogenase. Biochemistry 41:1315–1322. doi:10.1021/bi0117504.
    OpenUrlCrossRef
  29. 29.↵
    1. Warner JR,
    2. Copley SD
    . 2007. Pre-steady-state kinetic studies of the reductive dehalogenation catalyzed by tetrachlorohydroquinone dehalogenase. Biochemistry 46:13211–13222. doi:10.1021/bi701069n.
    OpenUrlCrossRefPubMedWeb of Science
  30. 30.↵
    1. Hayes JD,
    2. Flanagan JU,
    3. Jowsey IR
    . 2005. Glutathione transferases. Annu Rev Pharmacol Toxicol 45:51–88. doi:10.1146/annurev.pharmtox.45.120403.095857.
    OpenUrlCrossRefPubMedWeb of Science
  31. 31.↵
    1. Allocati N,
    2. Federici L,
    3. Masulli M,
    4. Di Ilio C
    . 2009. Glutathione transferases in bacteria. FEBS J 276:58–75. doi:10.1111/j.1742-4658.2008.06743.x.
    OpenUrlCrossRefPubMed
  32. 32.↵
    1. Wiktelius E,
    2. Stenberg G
    . 2007. Novel class of glutathione transferases from cyanobacteria exhibit high catalytic activities towards naturally occurring isothiocyanates. Biochem J 406:115–123. doi:10.1042/BJ20070328.
    OpenUrlAbstract/FREE Full Text
  33. 33.↵
    1. Sheehan D,
    2. Meade G,
    3. Foley VM,
    4. Dowd CA
    . 2001. Structure, function and evolution of glutathione transferases: implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem J 360(Pt 1):1–16.
    OpenUrlAbstract/FREE Full Text
  34. 34.↵
    1. Vuilleumier S
    . 1997. Bacterial glutathione S-transferases: what are they good for? J Bacteriol 179:1431–1441. doi:10.1128/jb.179.5.1431-1441.1997.
    OpenUrlFREE Full Text
  35. 35.↵
    1. Board PG,
    2. Baker RT,
    3. Chelvanayagam G,
    4. Jermiin LS
    . 1997. Zeta, a novel class of glutathione transferases in a range of species from plants to humans. Biochem J 328:929–935. doi:10.1042/bj3280929.
    OpenUrlAbstract/FREE Full Text
  36. 36.↵
    1. Saisawang C,
    2. Wongsantichon J,
    3. Ketterman AJ
    . 2012. A preliminary characterization of the cytosolic glutathione transferase proteome from Drosophila melanogaster. Biochem J 442:181–190. doi:10.1042/BJ20111747.
    OpenUrlAbstract/FREE Full Text
  37. 37.↵
    1. Itzhaki H,
    2. Woodson WR
    . 1993. Characterization of an ethylene-responsive glutathione S-transferase gene cluster in carnation. Plant Mol Biol 22:43–58. doi:10.1007/BF00038994.
    OpenUrlCrossRefPubMedWeb of Science
  38. 38.↵
    1. Anandarajah K,
    2. Kiefer PM, Jr,
    3. Donohoe BS,
    4. Copley SD
    . 2000. Recruitment of a double bond isomerase to serve as a reductive dehalogenase during biodegradation of pentachlorophenol. Biochemistry 39:5303–5311. doi:10.1021/bi9923813.
    OpenUrlCrossRefPubMed
  39. 39.↵
    1. Federici L,
    2. Masulli M,
    3. Bonivento D,
    4. Di Matteo A,
    5. Gianni S,
    6. Favaloro B,
    7. Di Ilio C,
    8. Allocati N
    . 2007. Role of Ser11 in the stabilization of the structure of Ochrobactrum anthropi glutathione transferase. Biochem J 403:267–274. doi:10.1042/BJ20061707.
    OpenUrlAbstract/FREE Full Text
  40. 40.↵
    1. Konishi T,
    2. Kato K,
    3. Araki T,
    4. Shiraki K,
    5. Takagi M,
    6. Tamaru Y
    . 2005. A new class of glutathione S-transferase from the hepatopancreas of the red sea bream Pagrus major. Biochem J 388:299–307. doi:10.1042/BJ20041578.
    OpenUrlAbstract/FREE Full Text
  41. 41.↵
    1. Zhou NY,
    2. Fuenmayor SL,
    3. Williams PA
    . 2001. nag genes of Ralstonia (formerly Pseudomonas) sp. strain U2 encoding enzymes for gentisate catabolism. J Bacteriol 183:700–708. doi:10.1128/JB.183.2.700-708.2001.
    OpenUrlAbstract/FREE Full Text
  42. 42.↵
    1. Liu K,
    2. Liu TT,
    3. Zhou NY
    . 2013. HbzF catalyzes direct hydrolysis of maleylpyruvate in the gentisate pathway of Pseudomonas alcaligenes NCIMB 9867. Appl Environ Microbiol 79:1044–1047. doi:10.1128/AEM.02931-12.
    OpenUrlAbstract/FREE Full Text
  43. 43.↵
    1. Larkin MA,
    2. Blackshields G,
    3. Brown NP,
    4. Chenna R,
    5. McGettigan PA,
    6. McWilliam H,
    7. Valentin F,
    8. Wallace IM,
    9. Wilm A,
    10. Lopez R,
    11. Thompson JD,
    12. Gibson TJ,
    13. Higgins DG
    . 2007. Clustal W and Clustal X version 2.0. Bioinformatics 21:2947–2948. doi:10.1093/bioinformatics/btm404.
    OpenUrlCrossRef
  44. 44.↵
    1. Robert X,
    2. Gouet P
    . 2014. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res 42:W320–W324. doi:10.1093/nar/gku316.
    OpenUrlCrossRefPubMedWeb of Science
  45. 45.↵
    1. Kumar S,
    2. Stecher G,
    3. Tamura K
    . 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol 33:1870–1874. doi:10.1093/molbev/msw054.
    OpenUrlCrossRefPubMed
  46. 46.↵
    1. Chu CW,
    2. Liu B,
    3. Li N,
    4. Yao SG,
    5. Cheng D,
    6. Zhao JD,
    7. Qiu JG,
    8. Yan X,
    9. He Q,
    10. He J
    . 2017. A novel aerobic degradation pathway for thiobencarb is initiated by the TmoAB two-component FMN-dependent monooxygenase system in Acidovorax sp. strain T1. Appl Environ Microbiol 83:e01490-17. doi:10.1128/AEM.01490-17.
    OpenUrlAbstract/FREE Full Text
  47. 47.↵
    1. Bradford MM
    . 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. doi:10.1016/0003-2697(76)90527-3.
    OpenUrlCrossRefPubMedWeb of Science
  48. 48.↵
    1. Livak KJ,
    2. Schmittgen TD
    . 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25:402–408. doi:10.1006/meth.2001.1262.
    OpenUrlCrossRefPubMedWeb of Science
  49. 49.↵
    1. Quandt J,
    2. Hynes MF
    . 1993. Versatile suicide vectors which allow direct selection for gene replacement in gram-negative bacteria. Gene 127:15–21. doi:10.1016/0378-1119(93)90611-6.
    OpenUrlCrossRefPubMedWeb of Science
  50. 50.↵
    1. Wang CH,
    2. Chen Q,
    3. Wang R,
    4. Shi C,
    5. Yan X,
    6. He J,
    7. Hong Q,
    8. Li SP
    . 2014. A novel angular dioxygenase gene cluster encoding 3-phenoxybenzoate 1′,2′-dioxygenase in Sphingobium wenxiniae JZ-1. Appl Environ Microbiol 80:3811–3818. doi:10.1128/AEM.00208-14.
    OpenUrlAbstract/FREE Full Text
  • Copyright © 2018 American Society for Microbiology.

All Rights Reserved.

PreviousNext
Back to top
Download PDF
Citation Tools
Roles of Two Glutathione-Dependent 3,6-Dichlorogentisate Dehalogenases in Rhizorhabdus dicambivorans Ndbn-20 in the Catabolism of the Herbicide Dicamba
Na Li, Ren-Lei Tong, Li Yao, Qing Chen, Xin Yan, De-Rong Ding, Ji-Guo Qiu, Jian He, Jian-Dong Jiang
Applied and Environmental Microbiology Aug 2018, 84 (17) e00623-18; DOI: 10.1128/AEM.00623-18

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Alerts
Sign In to Email Alerts with your Email Address
Email

Thank you for sharing this Applied and Environmental Microbiology article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
Roles of Two Glutathione-Dependent 3,6-Dichlorogentisate Dehalogenases in Rhizorhabdus dicambivorans Ndbn-20 in the Catabolism of the Herbicide Dicamba
(Your Name) has forwarded a page to you from Applied and Environmental Microbiology
(Your Name) thought you would be interested in this article in Applied and Environmental Microbiology.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Roles of Two Glutathione-Dependent 3,6-Dichlorogentisate Dehalogenases in Rhizorhabdus dicambivorans Ndbn-20 in the Catabolism of the Herbicide Dicamba
Na Li, Ren-Lei Tong, Li Yao, Qing Chen, Xin Yan, De-Rong Ding, Ji-Guo Qiu, Jian He, Jian-Dong Jiang
Applied and Environmental Microbiology Aug 2018, 84 (17) e00623-18; DOI: 10.1128/AEM.00623-18
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • INTRODUCTION
    • RESULTS
    • DISCUSSION
    • MATERIALS AND METHODS
    • ACKNOWLEDGMENTS
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

dicamba catabolism
3,6-dichlorogentisate
glutathione-dependent dehalogenases
dsmH2
6-dechlorination
eta class

Related Articles

Cited By...

About

  • About AEM
  • Editor in Chief
  • Editorial Board
  • Policies
  • For Reviewers
  • For the Media
  • For Librarians
  • For Advertisers
  • Alerts
  • RSS
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • ASM Author Center
  • Submit a Manuscript
  • Article Types
  • Ethics
  • Contact Us

Follow #AppEnvMicro

@ASMicrobiology

       

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

 

Print ISSN: 0099-2240; Online ISSN: 1098-5336