Article Figures & Data
Figures
- FIG 1
E. coli peptidoglycan synthesis and d,d-carboxypeptidase gene deletion. (A) The peptidoglycan biosynthesis pathway of E. coli. UDP-GlcNAc, UDP-N-acetylglucosamine; UDP-MurNAc, UDP-N-acetylmuramate; MurA, UDP-N-acetylglucosamine 1-carboxyvinyltransferase; MurB, UDP-N-acetylmuramate dehydrogenase; MurC, UDP-N-acetylmuramate-alanine ligase; MurD, UDP-N-acetylmuramoylalanine–d-glutamate ligase; MurE, UDP-N-acetylmuramoyl-l-alanyl–d-glutamate-2,6-diaminopimelate ligase; MurF, UDP-N-acetylmuramoyl-tripeptide-d-alanyl–d-alanine ligase; MraY, phospho-N-acetylmuramoyl-pentapeptide-transferase; MurG, UDP-N-acetylglucosamine–N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase; MtgA, monofunctional glycosyltransferase; ClassA PBP, penicillin-binding protein 1A; ClassA/B PBP, penicillin-binding protein 1A and penicillin-binding protein 2; DD-CPase, d,d-carboxypeptidases. (B) Nascent peptidoglycan chain synthesis with DD-CPase in the periplasm. During peptidoglycan synthesis, d,d-carboxypeptidases delete the C-terminal d-Ala from the majority of peptidoglycan precursor pentapeptide stem molecules. (C) Deletion of DD-CPase genes dacA and dacB (detailed gene deletion methods and data are included in the supplemental material). 1, BL21 ΔdacA ΔdacB; 2, BL21 ΔdacA ΔdacB::kan; 3, BL21 ΔdacB; and M, standard molecular weight markers.
- FIG 2
Effects of dacA and dacB deletion on cell growth. (A) Dry cell weight (DCW). Asterisks indicate a significant difference compared with control cells (none, P > 0.05; *, P < 0.05; and **, P < 0.01). (B) Specific growth rate, also known as relative growth rate (RGR), exponential growth rate, and continuous growth rate. RGR was calculated using the following equation from Hoffmann and Poorter (43): RGR = (lnW2 − lnW1)/(t2 − t1) where ln = natural logarithm, t1 = time 1 (e.g., in days), t2 = time 2 (e.g., in days), W1 = size at time 1, and W2 = size at time 2. Control, wild-type E. coli; ΔdacA, BL21 ΔdacA; ΔdacB, BL21 ΔdacB; and ΔdacA ΔdacB, BL21 ΔdacA ΔdacB.
- FIG 3
Analysis of glucosamine concentration. The y axis represents the glucosamine concentration of soluble peptidoglycan to indicate changes in intracellular soluble peptidoglycan concentration in different stains. Control, BL21-pETDuet; ΔdacA, BL21 ΔdacA pETDuet; ΔdacB, BL21 ΔdacB pETDuet; ΔdacA ΔdacB, BL21 ΔdacA ΔdacB pETDuet. Asterisks indicate a significant difference compared with control cells (none, P > 0.05; *, P < 0.05; and **, P < 0.01).
- FIG 4
Effects of dacA and dacB deletion on cell morphology. (A through D) Dot plot of cells using forward-scattered light (x axis) and side-scattered light (y axis). (E through H) Numbers of cells (y axis) according to the amount of forward-scattered light (x axis). (I through L) Effect of dacA and dacB deletion on cell morphology assessed by transmission electron microscopy (TEM). (A, E, and I) BL21-pETDuet (control cells). (B, F, and J) BL21 ΔdacA pETDuet. (C, G, and K) BL21 ΔdacB pETDuet. (D, H, and L) BL21 ΔdacA ΔdacB pETDuet.
- FIG 5
Effects of dacA and dacB deletion on extracellular recombinant green fluorescent protein (GFP) secretion. (A) Extracellular specific fluorescence intensity. AU, arbitrary units. Asterisks indicate a significant difference compared with control cells (none, P > 0.05; *, P < 0.05; and **, P < 0.01). (B) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. M, standard molecular weight markers; arrow, GFP; control, E. coli BL21-pETDUET-gfp (extracellular); ΔdacA, BL21 ΔdacA pETDuet-gfp; ΔdacB, BL21 ΔdacB pETDuet-gfp; ΔdacA ΔdacB, BL21 ΔdacA ΔdacB pETDuet-gfp; P-control, E. coli BL21-pETDuet-gfp (positive control, intracellular); N-control, E. coli BL21-pETDuet (negative control, intracellular).
- FIG 6
Effects of dacA and dacB deletion on extracellular recombinant amylase secretion. (A) Specific activity of extracellular amylase. Asterisks indicate a significant difference compared with control cells (none, P > 0.05; *, P < 0.05; and **, P < 0.01). (B) SDS-PAGE analysis of extracellular amylase. M, standard molecular weight markers; arrow, amylase; control, E. coli BL21-pETDuet-amy (extracellular); P-control, E. coli BL21-pETDuet-amy (positive control, intracellular); N-control, E. coli BL21-pETDuet (negative control, intracellular). (C) Extracellular amylase production rate. (D) Percentage of extracellular activity of total amylase activity. ΔdacA, BL21 ΔdacA pETDuet-amy; ΔdacB, BL21 ΔdacB pETDuet-amy; ΔdacA ΔdacB, BL21 ΔdacA ΔdacB pETDuet-amy.
- FIG 7
Effects of dacA and dacB deletion on extracellular α-galactosidase activity and outer membrane permeability. (A) Effects of dacA and dacB deletion on extracellular α-galactosidase activity. (B) Effects of dacA and dacB deletion on outer membrane permeability. Control, BL21-pETDuet; ΔdacA, BL21 ΔdacA pETDuet; ΔdacB, BL21 ΔdacB pETDuet; ΔdacA ΔdacB, BL21 ΔdacA ΔdacB pETDuet. Asterisks indicate a significant difference compared with control cells (none, P > 0.05; *, P < 0.05; and **, P < 0.01).
Tables
- TABLE 1
Plasmids and strains used in this work
Plasmid or strain Relevant genotype and/or characteristic(s) Source or reference Plasmids pMD19-T vector TA cloning TaKaRa pKD13 R6KY ori, Kanr, Ampr, Cmr CGSC pKD46 Ampr, helper plasmid CGSC pCP20 Ampr, Cmr, helper plasmid CGSC pETDuet T7 promoters, pBR322 ori, Ampr Novagen pET28a T7 promoters, pBR322 ori, Kanr Novagen pETDuet-gfp pETDuet derivate with gfp cloned This work pET28a-amy pET28a derivate with amy cloned This work Gene knockout cassettes ΔdacA::kan Kanr, knockout of gene dacA This work ΔdacA::kan′ Kanr, knockout of gene dacA of BL21 ΔdacB to obtain double deletion mutant This work ΔdacB::kan Kanr, knockout of gene dacB This work Strains E. coli JM109 Cloning host Novagen E. coli BL21 Wild-type E. coli BL21(DE3) Novagen BL21-pETDuet E. coli BL21 with plasmid pETDuet This work BL21-pETDuet-gfp E. coli BL21 with plasmid pETDuet-gfp This work BL21-pETDuet-amy E. coli BL21 with plasmid pETDuet-amy This work BL21-pKD46 E. coli BL21(DE3) derivate, including plasmid pKD46, Ampr This work BL21 ΔdacA::kan pKD46 BL21-pKD46 derivate, deleting dacA This work BL21 ΔdacB::kan pKD46 BL21-pKD46 derivate, deleting dacB This work BL21 ΔdacA ΔdacB::kan pKD46 BL21 ΔdacB pKD46 derivate, deleting ΔdacA ΔdacB This work BL21 ΔdacA::kan BL21 ΔdacA::kan pKD46 derivate, deleting plasmid pKD46 This work BL21 ΔdacB::kan BL21 ΔdacB::kan pKD46 derivate, deleting plasmid pKD46 This work BL21 ΔdacA ΔdacB::kan BL21 ΔdacA ΔdacB::kan pKD46 derivate, deleting plasmid pKD46 This work BL21 ΔdacA BL21 ΔdacA::kan derivate, deleting plasmid pKD46 and Kanr This work BL21 ΔdacB BL21 ΔdacB::kan derivate, deleting plasmid pKD46 and Kanr This work BL21 ΔdacA ΔdacB BL21 ΔdacA ΔdacB::kan derivate, deleting plasmid pKD46 and Kanr This work BL21 ΔdacA pETDuet BL21 ΔdacA derivate with plasmid pETDuet This work BL21 ΔdacB pETDuet BL21 ΔdacB derivate with plasmid pETDuet This work BL21 ΔdacA ΔdacB pETDuet BL21 ΔdacA ΔdacB derivate with plasmid pETDuet This work BL21 ΔdacA pETDuet-gfp BL21 ΔdacA derivate with plasmid pETDuet-gfp This work BL21 ΔdacB pETDuet-gfp BL21 ΔdacB derivate with plasmid pETDuet-gfp This work BL21 ΔdacA pETDuet-amy BL21 ΔdacA derivate with plasmid pETDuet-amy This work BL21 ΔdacB pETDuet-amy BL21 ΔdacB derivate with plasmid pETDuet-amy This work BL21 ΔdacA ΔdacB pETDuet-gfp BL21 ΔdacA ΔdacB derivate with plasmid pETDuet-gfp This work BL21 ΔdacA ΔdacB pETDuet-amy BL21 ΔdacA ΔdacB derivate with plasmid pETDuet-amy This work - TABLE 2
Nucleotide sequences of primers
Oligonucleotide primer or purposea Sequence (5′ to 3′)b Plasmid construction GFP-FW CGGAATTCATGAGTAAAGGAGAAGAACTTTTC GFP-RV GAAGATCTTTATTTGTATAGTTCATCCATGC Amy-FW CCGGAATTCATGAGCGAGCTGCCGCAAATC Amy-RV CCGCTCGAGTTAAAAACCGCCATTGAAGGACG Gene knockout ΔdacA-FW GGCTCTTTGCACAGCCTTTATCTCTGCTGCACATGCCGATGACCTGAATAGTGTAGGCTGGAGCTGCTTC ΔdacA-RV CGAAGAAGTTACCTTCCGGGATTTCTTGCAGTACAACCAACGGGCGTTGTATTCCGGGGATCCGTCGACC ΔdacB-FW GATTACCACAGTCAGCAGATGGCGCAGCCCGCCAGTACGCAGAAAGTGATGTGTAGGCTGGAGCTGCTTC ΔdacB-RV CATCCACGCCCGCCTGATGCAGACCTGCACGGTACTGCAAAGAGCCGTCAATTCCGGGGATCCGTCGACC ΔdacA′-1-FWc GCTCTTTGCACAGCCTTTATCT ΔdacA′-1-RV GAAGCAGCTCCAGCCTACACGAGGAACATCAGCGAAGAACC ΔdacA′-2-FW GGTTCTTCGCTGATGTTCCTCGTGTAGGCTGGAGCTGCTTC ΔdacA′-2-RV CAGTCGCAGAAGCAACAAGGATTCCGGGGATCCGTCGACC ΔdacA′-3-FW GGTCGACGGATCCCCGGAATCCTTGTTGCTTCTGCGACTG ΔdacA′-3-RV GTTACCTTCCGGGATTTCTTG ↵a FW, forward primer; RV, reverse primer.
↵b Italicized letters represent the restriction enzyme sites. Underlined letters represent homologous sequences used for gene knockout.
↵c Primers ΔdacA′-1 through ΔdacA′-3 were used to delete dacA of BL21 ΔdacB, and were redesigned in order to improve the efficiency of deletion. ΔdacA′-1, ΔdacA′-3, and ΔdacA′-2 were used to amplify forward and reverse homologous sequences and the Kanr gene.
Supplemental material
- Supplemental file 1 -
Supplemental text (CaCl2 method for preparation of competent E. coli cells, deletion of d,d-carboxypeptidase genes, electroporation transformation, determination of extracellular protein concentration, SDS-PAGE to determine effects of dacA and dacB deletion on extracellular recombinant FGFR2 and collagen E4 secretion, amino acid sequence of E4); DNA electrophoresis (Fig. S1); extracellular protein concentrations of recombinant strains (Table S1); extracellular recombinant amylase specific activities (Table S2); effects of dacA and dacB deletion on extracellular recombinant FGFR2 and E4 secretion (Fig. S2).
PDF, 949K
- Supplemental file 1 -
