Article Figures & Data
Figures
- FIG 1
Proportions or abundances of the amoA gene from comammox and AOB in 21 different environmental samples, assessed by two-step PCR with highly degenerate primers (THDP-PCR) (A) or by quantitative real-time PCR, compared with the abundance of the 16S rRNA gene from total bacteria (TB) (B). In panel A, the positive error bars indicate differences between the two sequencing methods (Illumina HiSeq and MiSeq). In panel B, the positive error bars indicate the standard deviation of three replicates, and the units of the results are copies per gram for soil/sediment/sludge samples, copies per liter for water samples and copies per square meter for leaf surface. An asterisk (*) indicates that the results were under the detection limit. For detailed information about the primer sets used in this analysis, please see Table 1.
- FIG 2
A ternary plot of the proportions of comammox, AOB, and AOA in 111 metagenomic data sets of different environmental samples from the NCBI SRA database with amoA gene sequence read numbers of at least 30. The numbers directed by arrows in the figure indicate the numbers of overlapping specific color circles. The numbers in parentheses denote the numbers of data sets used in this analysis for specific environmental types. For detailed information for each data set, please see Table S1.
- FIG 3
Maximum-likelihood phylogenetic tree of comammox AmoA based on 30 major OTUs (no less than 0.7%) with a 90% similarity cutoff. The data in parentheses following the OTU numbers indicate the average content of each OTU in the 18 different environmental samples amplified by comammox-specific partial nested PCR (amplification failed for the other three of the 21 samples). The data in parentheses following the bootstrap values indicate the bootstrap values in the neighbor-joining and maximum-parsimony trees. The details of the content of each OTU for each environmental sample are listed in Table S4.
- FIG 4
Relative proportions of the different clades of comammox in 18 different environmental samples (amplification failed for the other three of the 21 samples) analyzed using partial nested PCR with comammox-specific primer sets. For the detailed read numbers of different types of ammonia oxidizers, please see Table S3.
- FIG 5
Rarefaction curves of the number of OTUs, the Chao1 estimator, and the Shannon index using OTU similarity thresholds of 97% (A) and 90% (B) for the amoA gene among different comammox clades, AOB, and AOA, based on a combination of 1,900 randomly selected reads from each of the 12 different environmental samples from which comammox, AOB, and AOA amoA genes were efficiently amplified. For diversity index comparison of amoA genes of comammox, AOB, and AOA for each sample, please see Table S6.
Tables
- TABLE 1
Primers used in this study
Application Primer name Sequence (5′ to 3′)a Degeneracy Annealing temperature (°C) Amplicon length (bp) Source and/or reference(s) THDP-PCR for amoA/pmoA gene of comammox, AOB, and MOB A189Y-tag GCCGGAGCTCTGCAGATATCGGNGACTGGGAYTTYTGGb 16 59 513 27; this study HD616N-tag (first step) GCCGGAGCTCTGCAGATATCAYCWKVCKNAYRTAYTCNGGb 6,144 tag-barcode (second step) XXXXXXXXGCCGGAGCTCTGCAGATATCb,c 1 59 Partial nested PCR for the amoA gene of comammox A189Y GGNGACTGGGAYTTYTGG 16 52 415 This study C576r (first step) GAAGCCCATRTARTCNGCC CA209f GAYTGGAARGAYCGNCA 32 50 C576r-barcode (second step) XXXXXXXXXXXXGAAGCCCATRTARTCNGCCc 16 PCR for amoA gene of AOB amoA-1F-barcode XXXXXXXXXXXXGGGGTTTCTACTGGTGGTc 1 57 491 31 amoA-2R CCCCTCKGSAAAGCCTTCTTC 4 PCR for amoA gene of AOA Arch-amoAF-barcode XXXXXXXXXXXXSTAATGGTCTGGCTTAGACGc 2 53 635 24 Arch-amoAR GCGGCCATCCATCTGTATGT 1 qPCR for total bacterial 16S rRNA gene 338F ACTCCTACGGGAGGCAGC 1 55 200 39, 40 536R GTATTACCGCGGCKGCTG 2 qPCR for amoA gene of AOB amoA-1F GGGGTTTCTACTGGTGGT 1 57 491 31 amoA-2R CCCCTCKGSAAAGCCTTCTTC 4 qPCR for amoA gene of comammox clade A A378f TGGTGGTGGTGGTCNAAYTAT 8 55 278 This study C616r ATCATCCGRATGTACTCHGG 6 THDP-PCR for amoAB gene of comammox A378f-tag GCCGGAGCTCTGCAGATATCTGGTGGTGGTGGTCNAAYTATb 8 50 683 This study HDamo/pmoB (first step) GCCGGAGCTCTGCAGATATCCKCATBCKNADRAAYGGYTCb 1,152 tag-barcode (second step) XXXXXXXXGCCGGAGCTCTGCAGATATCb,c 1 59 ↵a Degenerate bases: R, A/G; Y, C/T; K, G/T; S, G/C; W, A/T; H, A/T/C; V, A/G/C; B, G/C/T; and N, A/T/C/G.
↵b The underlined bases indicate the sequences of the tag.
↵c XXXXXXXX and XXXXXXXXXXXX indicate the presence of 8- and 12-base barcodes, respectively, used to differentiate samples in high-throughput sequencing mixtures.
- TABLE 2
Diversity indices with 97% or 90% similarity cutoffs for comammox amoA gene sequencesa
Sample name Cutoff 97% 90% No. of OTUs Chao1 Shannon No. of OTUs Chao1 Shannon Dry land soil 82 160 3.00 36 66 2.43 Coal mine soil 64 99 3.17 41 59 2.08 Landfill soil 141 224 4.44 69 81 3.79 Paddy soil 85 139 3.89 37 46 2.96 Plateau soil 144 187 5.33 50 60 4.18 Forest soil 56 99 2.54 30 93 2.04 Tidal flat sediment 128 184 5.03 64 84 4.20 Saltmarsh sediment 117 148 4.25 66 73 3.83 Coastal sediment 76 144 3.55 41 53 3.06 River sediment 139 225 4.76 73 90 3.83 Lake sediment 111 211 2.81 49 65 2.22 Anaerobic sludge 51 181 1.93 26 59 1.66 Tap water 50 75 2.44 27 34 1.48 Coastal water 50 107 2.78 28 43 2.22 River water 162 243 4.87 61 84 3.86 Lake water 54 90 2.69 31 61 1.97 Leaf surface 78 152 3.40 38 114 2.84 ↵a Amplified with partial nested PCR in different environmental samples after the read numbers were rarified to 1,900 for each sample.
- TABLE 3
Coverage evaluation of primers based on the amoA gene sequencesa
Primer Clade (% [no./total]) AOB (% [no./total]) A.1 A.2 A B A189Y 99 (282/286) 97 (672/690) 98 (954/976) 94 (50/53) 98 (1,944/1,977) HD616N 97 (267/274) 96 (76/79) 97 (343/353) 67 (31/46) 51 (2,531/4,955) CA209f 98 (278/285) 86 (506/586) 90 (784/871) 98 (63/64) 98 (2,429/2,506) C576r 98 (277/283) 87 (72/83) 95 (349/366) 91 (30/33) 0 (0/5,051) A378f 78 (188/241) 73 (66/91) 77 (254/332) 0 (0/36) 0 (0/4,298) C616r 84 (231/274) 58 (46/79) 78 (277/353) 2 (1/46) 0 (0/4,951) A189 76 (217/286) 60 (415/690) 65 (632/976) 85 (45/53) 53 (1,045/1,977) A682 67 (130/194) 26 (24/92) 54 (154/286) 73 (35/48) 66 (412/626) ↵a Extracted from metagenomic or metatranscriptomic data sets in public databases, as described in Table S1. A sequence was considered to be covered by this primer if it had no mismatches or only one mismatch that was not located in the last four positions near the 3′ end. The numbers in parentheses denote the number of sequences matched with each primer and the number of extracted sequences that cover the region of this primer.
Supplemental material
- Supplemental file 1 -
Read numbers of comammox and AOB in 18 different environmental samples analyzed via partial nested PCR amplification of the comammox-specific amoA gene (Table S3); characteristics of various environmental samples analyzed in this study (Table S7); a ternary plot of the relative abundances of comammox, AOB, and AOA in 90 metatranscriptomic datasets of different environmental samples from the NCBI SRA database with amoA gene sequence read numbers of at least 30 (Fig. S1); gel image of different PCR products from river sediment, forest soil, and plateau soil samples (Fig. S2); neighbor-joining phylogenetic tree for comammox AmoA retrieved by partial nested PCR developed in this study and Nitrospira amoA-specific degenerate primers developed by Pjevac et al. (Fig. S3); rarefaction curves of the number of OTUs, the Chao1 estimator and the Shannon index using OTU similarity thresholds of 90% with same region of the amoA gene for comparisons of comammox and AOB and comammox and AOA based on a combination of 1,900 randomly selected reads from each of the 12 different environmental samples (Fig. S4); evaluation of the coverage of primer A682 for comammox bacteria (Fig. S5).
PDF, 929K
- Supplemental file 2 -
Read numbers of amoA and/or pmoA genes of AOA, AOB, comammox, and MOB in various environmental samples from metagenomic or metatranscriptomic datasets in the NCBI SRA database (Table S1).
XLSX, 97K
- Supplemental file 3 -
Read numbers of amoA and/or pmoA genes of AOA, AOB, comammox, and MOB in marine samples from metagenomic or metatranscriptomic datasets in the CAMERA database (Table S2).
XLSX, 15K
- Supplemental file 4 -
The 30 major OTUs (≥0.7%) of the comammox amoA gene with 90% similarity cutoff for each environment sample (Table S4).
XLSX, 18K
- Supplemental file 5 -
Amino acid similarity matrix of different comammox OTUs identified with a 90% similarity cutoff (Table S5).
XLSX, 174K
- Supplemental file 6 -
Diversity indices with 97% or 90% similarity cutoffs for comammox, AOB, and AOA amoA gene sequences in each of the 12 environmental samples after rarifying read numbers to 1,900 for each sample (Table S6).
XLSX, 12K
- Supplemental file 1 -
