Article Figures & Data
Figures
- FIG 1
Growth curves of E. coli DH5α wild-type and mutant strains. Cultivation was conducted for 5 h in LB at 37°C with aeration. The OD600 was determined over a period of 5 h for E. coli DH5α/pKMD3, DH5α Δhns/pKMD3, and DH5α Δhfq/pKMD3 strains. Data represent mean values and standard deviations from three biological replicates.
- FIG 2
Impact of deletion of genes hfq and hns on growth of STEC O113:H21 strain TS18/08. Optical density of wild-type strain (TS18/08), TS18/08/pKMD3 + pBR322 (TS18/08/pBR322) empty vector backbone control, TS18/08 Δhns/pKMD3 (TS18/08 Δhns) and TS18/08 Δhfq/pKMD3 (TS18/08 Δhfq) deletion mutants, and TS18/08 Δhns/pKMD3 + pLH02 (TS18/08 Δhns + hns) and TS18/08 Δhfq/pKMD3 + pLH01 (TS18/08 Δhfq + hfq) complemented strains is shown for measurements over 5 h. Data from three biological replicates are shown; error bars indicate standard deviations from mean values. Asterisks indicate statistical significance (P < 0.05) compared to values for TS18/08.
- FIG 3
Comparison of PsubAB1 promoter activities in DH5α and TS18/08. Relative reporter gene activity (RLU/OD600) is shown. Bars represent data for E. coli DH5α (dark blue) and an STEC strain (TS18/08, light blue). OD600 is shown as squares. Cultivation was conducted for 5 h in LB at 37°C with aeration. Data from three biological replicates are shown; error bars indicate standard deviations from mean values.
- FIG 4
Impact of Hfq on PsubAB1 activity in E. coli DH5α (A) and STEC E. coli TS18/08 (B). Relative reporter gene activity (RLU/OD600) is shown. Bars represent data from the wild-type strain (DH5α/pKMD3 [A] or TS18/08/pKMD3 [B], solid blue) and an empty vector control (DH5α/pKMD3 + pBR322 [A] or TS18/08/pKMD3 + pBR322 [B], dashed blue). Additionally, data from E. coli DH5α Δhfq/pKMD3 (DH5α Δhfq) (A) and E. coli TS18/08 Δhfq/pKMD3 (TS18/08 Δhfq) (B) (solid green) deletion mutants and DH5α Δhfq/pKMD3 + pLH01 (DH5α Δhfq + hfq) (A) and TS18/08 Δhfq/pKMD3 + pLH01 (TS18/08 Δhfq + hfq) (B) (dashed green) complemented strains are depicted. Data are presented for measurements over 5 h of cultivation in LB at 37°C with aeration. Data from three biological replicates are shown; error bars indicate standard deviations from mean values. Statistical significance compared to the wild-type strain is indicated (*, P < 0.05; **, P < 0.01).
- FIG 5
Impact of H-NS on PsubAB1 activity in E. coli DH5α (A) and STEC TS18/08 (B). Relative (rel.) reporter gene activity (RLU/OD600) is shown. Bars represent data from the wild-type strain (DH5α/pKMD3 [A] or TS18/08/pKMD3 [B], blue) and an empty vector control (DH5α/pKMD3 + pBR322 [A] or TS18/08/pKMD3 + pBR322 [B], dashed blue). Additionally, data from E. coli DH5α Δhns/pKMD3 (DH5α Δhns) (A) and E. coli TS18/08 Δhns/pKMD3 (TS18/08 Δhns) (B) (solid red) deletion mutants and DH5α Δhns/pKMD3 + pLH01 (DH5α Δhns + hns) (A) and TS18/08 Δhns/pKMD3 + pLH01 (TS18/08 Δhns + hns) (B) (dashed red) complemented strains are depicted. Data are presented for measurements over 5 h of cultivation in LB at 37°C with aeration. Data from three biological replicates are shown; error bars indicate standard deviations from mean values. Statistical significance compared to the wild-type strain is indicated (**, P < 0.01).
- FIG 6
Expression of subAB1, stx2, and cdt-V in E. coli TS18/08 Δhfq (A) and TS18/08 Δhns (B) strains. Transcription is shown as fold change relative to the level of the control (E. coli TS18/08). Gene expression was measured under standard batch conditions (LB medium, 37°C, with aeration) using quantitative real-time PCR. Quantification was conducted using rrsB as a reference gene. Error bars indicate standard deviations from the mean values. Data from three biological replicates are shown. Asterisks indicate significance in fold change compared to the level for the control (P < 0.05).
- FIG 7
Plasmid map of the luciferase reporter gene plasmid pKMD3. The putative promoter region of subAB1 (405 bp; PsubAB1) was cloned upstream of the luciferase reporter gene luc (1,652 bp) in the pWSK29 backbone restricted with PvuII (pWSK29_PvuII).
- FIG 8
Cloning strategy of complementation vectors pLH01 (A) and pLH02 (B). Positions of hns and hfq genes refer to the genome sequence of E. coli DH5α (NCBI accession number NZ_JRYM01000001).
Tables
- TABLE 1
Strains and plasmids used in this study
Strain or plasmid Relevant geno- and phenotypea Reference or source E. coli DH5α tonA lacZΔM15 endA1 recA1 thi-1 supE44 phoA gyrA96 hsdR17 Δ(lacZYA-argF)U169 relA1 Invitrogen DH5α Δhns tonA lacZΔM15 endA1 recA1 thi-1 supE44 phoA gyrA96 hsdR17 Δ(lacZYA-argF)U169 relA1 Δhns This study DH5α Δhfq tonA lacZΔM15 endA1 recA1 thi-1 supE44 phoA gyrA96 hsdR17 Δ(lacZYA-argF)U169 relA1 Δhfq This study HB101 F− mcrB mrr hsdS20(rB− mB−) recA13 leuB6 ara-14 proA2 lacY1 galK2 xyl-5 mtl-1 rpsL20 (Smr) supE44 λ− 52 TS18/08 O113:H21, cdt-V+ subAB1+ stx2+ 26 TS18/08 Δhns O113:H21, cdt-V+ subAB1+ stx2+ Δhns This study TS18/08 Δhfq O113:H21, cdt-V+ subAB1+ stx2+ Δhfq This study Plasmids pKD46 Contains genes of red recombinase system under control of araB promoter, Ampr 46 pKD4 Template plasmid for kanamycin resistance cassette, Ampr, Kanr 46 pCP20 Contains genes for FLP recombinase, Ampr 46 pKMD3 Luciferase reporter gene plasmid containing the subAB1 promoter region This study pBR322 Cloning vector, pMB1 origin of replication, Ampr, Tetr 53 p3121 Luciferase reporter gene (luc) template vector, Ampr, Kanr 54 pWSK29 Cloning vector (low copy number), Ampr 55 pLH01 Complementation plasmid, pBR322 backbone, with hfq gene under control of its own promoter, Tetr This study pLH02 Complementation plasmid, pBR322 backbone, with hns gene under control of its own promoter, Tetr This study ↵a Ampr, ampicillin resistance gene; Kanr, kanamycin resistance gene; Tetr, tetracycline resistance gene.
- TABLE 2
Oligonucleotide primers used in this study
Primer and/or category Use Nucleotide sequencea (5′ to 3′) Source Hfq_for Detection of hfq gene ATGGCTAAGGGGCAATCTTTACAAG This study Hfq_rev Detection of hfq gene TTATTCGGTTCTTCGCTGTCCTG This study Hns_for Detection of hns gene TTATTGCTTGATCAGGAAATCGTCG This study Hns_rev Detection of hns gene ATGAGCGAAGCACTTAAAATTCTG This study Mutagenesis Del_hfq_for Deletion of hfq gene, creation of resistance cassette AATGTGTACAATTGAGACGTATCGTGCGCATTTTTTCAGAATCGCGATTGTGTAGGCTGGAGC This study Del_hfq_rev Deletion of hfq gene, creation of resistance cassette AGCGTATAACCCTCTAAATAGATCAGCGGGGAACGCAGGATCCATGGTCCATATGAATATCCTCC This study Hfq + 186up_for Verification of deletion of hfq CCTGGCTGCGTGGTTGGGAAG This study Hfq-176down_rev Verification of deletion of hfq ACCAGAGATTCAAACTCCTGGAGGTC This study Del-hns_for Deletion of hns gene, creation of resistance cassette ACATCCGTATCGGTGTTACCACGAAACGGCGTTGAGCAATCGCGATTGTGTAGGCTGGAGC This study Del-hns_rev Deletion of hns gene, creation of resistance cassette ATAGGGAATTCTCGTAAACACAACTAATACAGAAGACTGAAAGGCATGGTCCATATGAATATCCTCC This study Hns + 244up_for Verification of deletion of hns TAGGTTACATGCAGGCCTTCGTTG This study Hns-705down_rev Verification of deletion of hns ACAGTGCGCATGCCGCGTTCC This study Construction of complementation plasmids Hfq + 86up_AseI_for Complementation studies GGGGGGGGGGattaatAATGTGTACAATTGAGACGTATCGTGCGCAATTTTTTCAGAATC This study Hfq-76down_PvuI_rev Complementation studies GGGGGcgatcgAGCGTATAACCCTCTAAATAGATCAGCGGGGAACGCAGGATC This study Hns + 144up_AseI_for Complementation studies CCCCCCaattaatACATCCGTATCGGTGTTATCCACGAAACGGCGTTGAGCAATC This study Hns-300down_PvuI_rev Complementation studies CCCCCCcgatcgATAGGGAATTCTCGTAAACACAACTAATACAGAAGACTGAAAGG This study Construction of luciferase reporter gene plasmid pKMD3 subAB-gibson_for Cloning of subAB1 promoter region for pKMD3 TTCGCTATTACGCCAGCTGAACGGTATCGATCCG This study subAB-gibson_rev Cloning of subAB1 promoter region for pKMD3 GTCTTCCATAAGCTCCTCCAGTTAGTAC This study luc-gibson_for Cloning of luc for pKMD3 AGGAGCTTATGGAAGACGCCAAAAAC This study luc-gibson_rev Cloning of luc for pKMD3 CCGATTCATTAATGCAGTCACAATTTGGACTTTCCG This study Gibson-1_for Verification of pKMD3 ACACCCGCCGCGCTTAATGC This study Seq 2-gibson_rev Verification of pKMD3 GATACCGCTCGCCGCAGCCG This study Seq 3-gibson_for Verification of pKMD3 GGTTGTGGATCTGGATGCCG This study Seq 4-gibson_rev Verification of pKMD3 AGGGCGTATCTCTTCATAGC This study ↵a Underlined bases depict homologous regions in mutagenesis, and underlined lowercase letters depict restriction sites for cloning strategy.
- TABLE 3
Oligonucleotide primers used for transcription analysis by qRT-PCR
Primer Nucleotide sequence (5’ to 3’ direction) PCR product size and conditions Reference rrsB-for GCATAACGTCGCAAGACCAAA 91 bp; 95°C, 10 s; 60.0°C, 30 s; 72°C, 10 s 51 rrsB-rev GCCGTTACCCCACCTACTAGCT RTsubAB-2-for GCAGGTATTATGGGATGTCT 177 bp; 95°C, 15 s; 60.3°C, 20 s; 72°C, 10 s 12 RTsubABrev GCAGGCACTTATGGAGGAG Upper-stx2 TCATATCTGGCGTTAATGGAGTTC 99 bp; 95°C, 10 s; 52.4°C, 30 s; 72°C, 10 s 51 Lower-stx2 GCGTAAGGCTTCTGCTGTG RTCDTA-for CCGATGGTAACACGCAATG 184 bp; 95°C, 10 s; 53.0°C, 30 s; 72°C, 10 s 12 RTCDTA-rev GCCTTAATGGTTCGCTTATGG
Supplemental material
- Supplemental file 1 -
Fig. S1 and S2
PDF, 158K
- Supplemental file 1 -
