ABSTRACT
Lactobacillus plantarum is a versatile bacterium that occupies a wide range of environmental niches. In this study, we found that a bifunctional aldehyde-alcohol dehydrogenase-encoding gene, adhE, was responsible for L. plantarum being able to utilize mannitol and sorbitol through cross-regulation by two DNA-binding regulators. In L. plantarum NF92, adhE was greatly induced, and the growth of an adhE-disrupted (ΔadhE) strain was repressed when sorbitol or mannitol instead of glucose was used as a carbon source. The results of enzyme activity and metabolite assays demonstrated that AdhE could catalyze the synthesis of ethanol in L. plantarum NF92 when sorbitol or mannitol was used as the carbon source. AcrR and Rex were two transcriptional factors screened by an affinity isolation method and verified to regulate the expression of adhE. DNase I footprinting assay results showed that they shared a binding site (GTTCATTAATGAAC) in the adhE promoter. Overexpression and knockout of AcrR showed that AcrR was a novel regulator to promote the transcription of adhE. The activator AcrR and repressor Rex may cross-regulate adhE when L. plantarum NF92 utilizes sorbitol or mannitol. Thus, a model of the control of adhE by AcrR and Rex during L. plantarum NF92 utilization of mannitol or sorbitol was proposed.
IMPORTANCE The function and regulation of AdhE in the important probiotic genus Lactobacillus are rarely reported. Here we demonstrated that AdhE is responsible for sorbitol and mannitol utilization and is cross-regulated by two transcriptional regulators in L. plantarum NF92, which had not been reported previously. This is important for L. plantarum to compete and survive in some harsh environments in which sorbitol or mannitol could be used as carbon source. A novel transcriptional regulator AcrR was identified to be important to promote the expression of adhE, which was unknown before. The cross-regulation of adhE by AcrR and Rex is important to balance the level of NADH in the cell during sorbitol or mannitol utilization.
INTRODUCTION
Lactobacillus is the largest and most diverse genus of lactic acid bacteria, which occupy a wide range of niches. There are more than 200 species in the genus Lactobacillus, and their environmental distribution is extremely variable. Some Lactobacillus species, such as Lactobacillus helveticus, Lactobacillus johnsonii, and Lactobacillus gasseri, are observed exclusively in some specific habitats, while some other species, for example, Lactobacillus plantarum, are highly versatile (1–3). L. plantarum is found in a variety of ecological niches, such as plants, vegetables, meat, dairy products, fermented food, and the gastrointestinal tracts of human and animals (4). A universal set of genes are maintained and employed in the variable and flexible genome of L. plantarum, enabling it to thrive in many different environments (2).
To allow the organism to compete and survive better in various harsh environments, for example, in mouse intestine, genes that are involved in nutrient acquisition and synthesis, transcription regulation, and adaptation to environmental stresses in L. plantarum are induced (5, 6). The relative expression level of a bifunctional aldehyde-alcohol dehydrogenase-encoding gene, adhE, is reported to be consistently increased by up to 350-fold in L. plantarum WCFS1 throughout the digestive tract, including the stomach, small intestine, cecum, and colon, compared with that in a rich laboratory medium. It seems that adhE is involved in bacterial adaptation to the changing environment and nutritional resources available in the gastrointestinal tract (7). However, the relevance of adhE and the adaption of L. plantarum to the environment or nutritional resources is unknown.
AdhE is a bifunctional alcohol and acetaldehyde dehydrogenase involved in metabolism during fermentation, and it is composed of an aldehyde dehydrogenase (ALDH) domain at the N terminus and an alcohol dehydrogenase (ADH) domain at the C terminus. AdhE has been reported to catalyze ethanol (EtOH) formation in Clostridium thermocellum and Thermoanaerobacterium saccharolyticum (8) and ethanol oxidation in Acetobacterium woodii (9), to facilitate anaerobic growth in Escherichia coli (10), and to anchor to the host-cell receptor Hsp60 in Listeria monocytogenes (11). In E. coli, the expression of adhE is regulated by several different regulators in the presence of nitrate, fructose-1-phosphate, or fructose-1,6-bisphosphate (12–15); however, how the bacterium senses and adapts to them is unclear. It has been reported that the transcriptional level of adhE is upregulated in E. coli and Salmonella enterica serovar Typhimurium when sorbitol rather than glucose is used as a sole carbon source (10, 16). Sorbitol and mannitol are present naturally in a wide variety of foods, especially in fruits and vegetables, and also frequently exist in the human intestinal tract as sugar substitutes (17). Mannitol is also a natural fermentation product of many organisms in intestinal habitats, such as heterofermentative lactic acid bacteria and yeast (18). L. plantarum is reported to have the ability to utilize sorbitol or mannitol (19–21); however, the function and regulation mechanism of adhE in sorbitol and mannitol utilization in Lactobacillus are not entirely clear.
Here we found that the adhE gene in L. plantarum strain NF92 is adjacent to the sorbitol phosphotransferase system (PTS) operon and is highly upregulated when the strain is growing in either sorbitol- or mannitol-containing medium compared with glucose-containing medium. An in vitro assay showed that AdhE functions to catalyze ethanol synthesis during mannitol or sorbitol utilization. To adapt to the changes in carbon source, adhE is cross-regulated by two DNA-binding proteins, i.e., the novel activator AcrR and the repressor Rex.
RESULTS
AdhE plays an important role in sorbitol or mannitol utilization in L. plantarum NF92.An L. plantarum strain named NF92 was isolated from the fermented grains of a Chinese liquor named Niulanshan in De Man-Rogosa-Sharp (MRS) medium. The 16S rRNA sequence of NF92 showed 100% identity to that of L. plantarum strain JCM 1149, and its draft genome was sequenced by using Illumina HiSeq. The locus tags of genes in L. plantarum NF92 are listed in Table S1 in the supplemental material. In the genome of L. plantarum NF92, adhE was observed to be adjacent to the gene clusters for d-ribose degradation and the sorbitol PTS (Fig. 1A). We presumed that adhE might participate in d-ribose or sorbitol utilization. To investigate the function of adhE in L. plantarum NF92, an adhE-disrupted (ΔadhE) strain was constructed via allelic replacement with a chloramphenicol-resistant gene insertion. An adhE-complemented strain (P-adhE) was also constructed. The growth of the wild-type (WT), ΔadhE, and P-adhE strains was measured in MRS medium (with glucose as main carbon source) or in MRSD or MRSS medium (where the glucose in MRS medium was replaced by d-ribose or sorbitol, respectively). As shown in Fig. 1, there was no obvious difference in the growth of the three tested strains in glucose (Fig. 1B) or d-ribose (Fig. 1C). However, in sorbitol, the growth of the ΔadhE strain was largely reduced compared with that of the WT and P-adhE (Fig. 1D). The same phenomenon was also found in strains growing in mannitol (the isomer of sorbitol) (Fig. 1E). These results demonstrate that adhE may be involved in sorbitol and mannitol utilization in L. plantarum NF92. The transcriptional levels of adhE in L. plantarum NF92 growing in different sugars were analyzed by quantitative reverse transcription-PCR (qRT-PCR). The results showed that the expression of adhE was increased by 883-fold when L. plantarum NF92 was grown in sorbitol and by 442-fold when it was grown in mannitol compared with that in glucose (Fig. 1F). These results illustrate that AdhE plays an important role in sorbitol or mannitol utilization in L. plantarum NF92.
The importance of AdhE in sorbitol and mannitol utilization. (A) Downstream gene clusters of adhE. rbsR, LacI family transcriptional regulator, ribose; rbsK, ribokinase; rbsD, d-ribose pyranase; rbsU, ribose transport protein; srlD, sorbitol-6-phosphate 2-dehydrogenase; srlR, sorbitol operon transcription antiterminator, BglG family; srlM, sorbitol operon activator; ptsC, PTS, glucitol/sorbitol-specific EIIC component; ptsBC, PTS sorbitol transporter subunit IIB; ptsA, PTS sorbitol transporter subunit IIA. (B to E) Effects of adhE disruption on growth in glucose (B), d-ribose (C), sorbitol (D), and mannitol (E). (F) qRT-PCR transcriptional analysis of adhE when L. plantarum NF92 was grown in glucose, mannitol, or sorbitol. Relative values were obtained using the transcription of the 16S rRNA-coding gene as a reference. The cDNA used as the template in this experiment was diluted 10-fold for adhE but diluted 10,000-fold for the 16S rRNA-coding gene. The x axis represents the different carbon sources. Mean values and standard deviations were calculated from three independent experiments. **, P < 0.01.
AdhE prefers producing EtOH to utilizing EtOH in L. plantarum NF92.To identify the function of AdhE in L. plantarum NF92, AdhE was expressed in E. coli and purified with an Ni2+ column. Its specific activity and enzyme kinetics were tested under physiological conditions of pH 7.0 and 30°C. The specific activity of the reduction reaction (acetyl coenzyme A [acetyl-CoA]→ethanol [EtOH]) catalyzed by AdhE was detected as 7.92 U/mg, which was 43-fold higher than that of the oxidation reaction (EtOH→acetyl-CoA) (Table 1), and the ethanol synthesis reaction presented a Km 4.75-fold lower and a kcat 20-fold higher than those for the ethanol degradation reaction. These results demonstrate that AdhE has a stronger substrate affinity and catalytic rate in the ethanol synthesis reaction. Moreover, the catalytic efficiency (kcat/Km) of the ethanol production reaction was nearly 95-fold higher than that of the ethanol consumption reaction (Table 1), indicating that AdhE prefers to produce ethanol instead of utilizing ethanol.
Enzyme characteristics of purified AdhEa
In order to test whether AdhE could catalyze ethanol synthesis in vivo, the WT, ΔadhE, and P-adhE strains were cultured in MRS, MRSS, or MRSM medium, and the consumption of carbon sources and production of ethanol were detected. No ethanol was detected in each of these three strains when they were grown in glucose, and no significant difference were found in glucose consumption by these three strains during the whole fermentation process (Fig. 2A and D). These results demonstrate that AdhE may not be involved in ethanol production in L. plantarum NF92 when glucose is afforded as the carbon source. However, when either sorbitol or mannitol was used as the carbon source, ethanol production could be detected in both the WT and P-adhE strains but not in the ΔadhE strain (Fig. 2B and C). Meanwhile, sorbitol and mannitol were almost used up at 48 h in the WT strain and only about 15% to 28% consumed even at 60 h in the ΔadhE strain (Fig. 2E and F). These results indicate that AdhE prefers catalyzing ethanol synthesis in L. plantarum NF92 in the presence of sorbitol or mannitol.
Effects of adhE disruption on production of ethanol or lactic acid and consumption of sugar or acetate. (A to C) Ethanol production by the WT, ΔadhE, and complemented P-adhE strains grown in glucose (A)-, sorbitol (B)-, and mannitol (C)-containing media. (D to F) Glucose (D), sorbitol (E), and mannitol (F) consumption by the WT, ΔadhE, and complemented P-adhE strains. (G to I) Lactic acid production by the WT, ΔadhE, and complemented P-adhE strains grown in glucose (G)-, sorbitol (H)-, and mannitol (I)-containing media. (J to L) Acetate consumption by the WT, ΔadhE, and complemented P-adhE strains grown in glucose (J)-, sorbitol (K)-, and mannitol (L)-containing media. Mean values and standard deviations were calculated from experiments performed in triplicate.
Lactic acid is usually a main metabolite of L. plantarum when glucose is used as a carbon source. Acetate is also the major fermentation end product of L. plantarum at the stationary growth phase under aerobic conditions and sugar limitation (22). As shown in Fig. 2G, there was no obvious difference in the production of lactic acid in the WT, ΔadhE, and P-adhE strains when they were grown in MRS medium. However, the production of lactic acid was largely reduced in the ΔadhE strain and partly complemented in P-adhE when sorbitol (Fig. 2H) or mannitol (Fig. 2I) was utilized. Meanwhile, there was no obvious difference in the content of acetate through the whole fermentation process in the cultures of the WT, ΔadhE, and P-adhE strains when glucose was utilized (Fig. 2J). When sorbitol or mannitol was used as a carbon source, the acetate was consumed by the WT and P-adhE strains but not by the ΔadhE strain (Fig. 2K and L). These results indicate that AdhE may also be involved in the utilization of acetate when sorbitol or mannitol is used as the carbon source.
Identification of AcrR and Rex as adhE regulators during sorbitol or mannitol utilization.The predicted promoter sequence of adhE (PadhE) was analyzed, and several inverted repeat sequences were found to form hairpins (Fig. 3A). We proposed that adhE might be regulated by several transcriptional regulators. A biotinylated PadhE DNA fragment was used as a probe for regulators that might interact with PadhE directly from the total lysate of L. plantarum NF92 which was cultured in MRSS or MRSM medium. Eleven and 17 DNA-binding proteins that might interact with PadhE were found and were identified by liquid chromatography-tandem mass spectrometry (LC-MS/MS) when L. plantarum NF92 was grown in MRSS or MRSM medium, respectively.
Identification of regulators for adhE during sorbitol and mannitol utilization. (A) Secondary structure of PadhE, which was predicted by using DNAMAN. (B to D) EMSAs of LysR (B), AcrR (C), and Rex (D) binding to the upstream region of adhE. Each lane contained 20 ng of DNA probe.
Among these DNA-binding proteins, five potential PadhE-binding proteins were identified when L. plantarum NF92 was grown in either sorbitol or mannitol (Table 2). They were HU (a DNA-binding protein), LytR (a transcriptional regulator), AcrR (a TetR family bacterial regulatory protein), LysR (a helix-turn-helix [HTH]-type transcriptional regulator), and Rex (a redox-sensing transcriptional repressor). The DNA-binding protein HU is a conserved nucleoid-associated protein (NAP) which binds nonspecifically to duplex DNA, with a particular preference for nicked and bent DNA. LytR is more specific to the anionic cell wall polymer biosynthesis enzyme Cps2a, which is involved in cell wall/membrane/envelope biogenesis. We proposed that neither of them was the specific protein that regulated adhE. AcrR contains 191 residues and belongs to the TetR/AcrR transcription regulator family, which is reported to regulate processes of antibiotic production, the osmotic stress response, and multidrug resistance. LysR is an HTH-containing transcriptional regulator belonging to the LysR family, which controls genes relating to amino acid biosynthesis, degradation of aromatic compounds, oxidative stress responses, etc. Rex is a redox-sensing transcriptional repressor which is reported to be capable of binding to the promoter of adhE in Staphylococcus aureus (23), Thermoanaerobacter ethanolicus (24), and Clostridium acetobutylicum (25). As a result, we proposed that AcrR, LysR, and Rex might regulate the expression of adhE in L. plantarum NF92.
Potential PadhE-binding proteins identified in sorbitol and mannitol
The AcrR, LysR, and Rex proteins were expressed and purified from E. coli BL21. An electrophoretic mobility shift assay (EMSA) was performed to test the ability of each protein to bind to PadhE. As shown in Fig. 3B, no shift band was observed in lanes with LysR added as a DNA-binding protein, even when LysR was added to a high concentration of up to 750 nM, demonstrating that LysR may not be involved in adhE regulation. Both AcrR and Rex could bind to PadhE and showed protein concentration-dependent interactions (Fig. 3C and D). These results indicate that AcrR and Rex may participate in the regulation of adhE when L. plantarum NF92 utilizes sorbitol or mannitol.
To identify the possible binding sites of AcrR and Rex to PadhE, a DNase I footprinting assay was performed. A 41-bp AcrR-binding site on PadhE, which is located at bp −206 to −166 upstream of adhE start codon ATG, was identified (Fig. 4A). The 41-bp fragment was inserted into a nonspecific DNA fragment (fragment A [FA]) to create fragment B (FB). The EMSA results showed that AcrR could bind to FB but not FA (Fig. 4C), thus indicating that AcrR can bind to the 41-bp region of PadhE. This region contains 5-bp (TTGTT) and 7-bp (GTTCATT) repeat sequences, which overlap to form a 23-bp repeat sequence (TTGTTCATTAATGAACTTAACAA). A 14-bp sequence (GTTCATTAATGAAC) which is located in this 23-bp repeat fragment is consistent with the third palindromic sequence in the structure of PadhE (Fig. 3A). Two regions located in PadhE at bp −194 to −169 and bp −90 to −59 upstream of the adhE start codon ATG were also identified as Rex protein-binding sites by DNase I footprinting assay (Fig. 4B). Each region was inserted into the nonspecific DNA fragment FA, and their ability to bind to Rex was further confirmed by EMSA (Fig. 4D). Interestingly, the first binding site (site I) is located in the AcrR-binding site which shows the same repeat sequences (GTTCATTAATGAAC), implying that these two regulators may have cross-regulation at this position during sorbitol or mannitol utilization. The second site (site II) contains two repeat sequences (AATTT and TTGC) and is included in the sixth palindromic sequence in the structure of PadhE (Fig. 3A).
Identification of the binding sites for AcrR and Rex on PadhE. (A) Determination of AcrR-binding sites on PadhE by DNase I footprinting. Each lane contained 1.6 μg of DNA probe, which was incubated with increasing concentrations of AcrR protein (0.1, 0.5, 1, and 5 μM). DNA probe incubated with 7 μM bovine serum albumin (BSA) was used as the negative control. (B) Determination of Rex-binding sites on PadhE by DNase I footprinting. The concentrations of Rex protein were 0.5, 1, and 5 μM. (C) Binding of AcrR to the 41-bp sequence (site I) containing the 14-bp repeat sequence GTTCATTAATGAAC. FB contained the 41-bp sequence. FA, nonspecific DNA as a negative control; PadhE, positive control. Each lane contained 20 ng DNA fragment and either 0 or 200 nM AcrR, as indicated. (D) Binding of Rex to site I or site II. FC, insertion of the 41-bp sequence in FA, containing site II.
AcrR promotes the transcription of adhE during sorbitol and mannitol utilization.To test the effect of AcrR on the transcription of adhE, acrR overexpression strain AcrR+ was constructed. The WT+ control (containing the empty plasmid pMG36c [M]) and AcrR+ strains were cultured in MRSS or MRSM medium, and the transcriptional level of adhE was analyzed by qRT-PCR. In AcrR+, adhE was upregulated by 4.5-fold in sorbitol and 2.8-fold in mannitol compared with the levels in WT+ (Fig. 5A), indicating that AcrR may promote the expression of adhE when L. plantarum NF92 utilizes sorbitol or mannitol. Further, total RNAs were prepared from the WT strain, the acrR knockout △acrR strain, and the acrR-complemented strain P-acrR which were grown in MRSS or MRSM. The transcriptional level of adhE was checked by qRT-PCR. The results showed that the transcription of adhE was reduced in the △acrR strain and could be restored in P-acrR in sorbitol or mannitol (Fig. 5B). These results verify that AcrR is a positive regulator of adhE during L. plantarum NF92 growth in sorbitol- or mannitol-containing medium.
qRT-PCR transcriptional analysis of adhE in the WT, AcrR+, △acrR, and P-acrR strains. (A) Effects of acrR overexpression on adhE transcription when sorbitol or mannitol was used as a carbon source. (B) Effects of acrR disruption on adhE transcription when sorbitol or mannitol was used as a carbon source. Relative values were obtained using the transcription of the 16S rRNA-coding gene as a reference. The cDNA used as the template in this experiment was diluted 10-fold for adhE but diluted 10,000-fold for the 16S rRNA-coding gene. The x axis represents the different carbon sources. Mean values and standard deviations were calculated from three independent experiments. **, P < 0.01.
Rex acts as a repressor of adhE expression during sorbitol and mannitol utilization.In order to check the regulation of Rex on adhE expression, rex was overexpressed in L. plantarum NF92, forming strain Rex+. As shown in Fig. 6, the transcriptional level of adhE in strain Rex+ was reduced by 1.5-fold in sorbitol and 2.5-fold in mannitol compared with that in the wild-type strain (Fig. 6A). It has been reported that Rex is a NADH-binding protein in other bacteria (23–25). Here, in L. plantarum NF92, we found that NADH addition led to a certain degree of PadhE dissociation from the Rex-PadhE complexes (Fig. 6B). This result indicates that NADH may decrease the interaction of Rex and PadhE through its competitive binding to Rex. Rex in L. plantarum may act as a repressor of adhE expression, which could be decreased by NADH addition.
Function of Rex in regulating adhE. (A) qRT-PCR transcriptional analysis of adhE in the WT and Rex+ strains when sorbitol or mannitol was used as a carbon source. Relative values were obtained using the transcription of the 16S rRNA-coding gene as a reference. The cDNA used as the template in this experiment was diluted 10-fold for adhE but diluted 10,000-fold for the 16S rRNA-coding gene. The x axis represents the different carbon sources. Mean values and standard deviations were calculated from three independent experiments. **, P < 0.01. (B) Effects of NADH on binding of Rex to PadhE as determined by EMSA. The concentrations of NADH were 0, 0.5, 1, and 2 mM, and 200 nM Rex was used.
DISCUSSION
L. plantarum can survive in many different ecological niches. In the genome of L. plantarum WCFS1, there are a variety of genes; for example, there are 25 complete PTS enzyme II complex-related genes, involved in sugar uptake and utilization (4). In this study, we found that the aldehyde-alcohol dehydrogenase AdhE was essential for L. plantarum NF92 to utilize sorbitol and mannitol. The complete genomes of Lactobacillus spp. in the NCBI database were analyzed, and adhE was found widely distributed in Lactobacillus (see Fig. S1 in the supplemental material). A previous study reported that adhE was present in almost all heterofermentative lactobacilli and was also found in homofermentative lactobacilli (26). In L. plantarum NF92, adhE is positioned next to gene clusters encoding d-ribose and a sorbitol PTS, and this genetic structure is present in the genomes of most L. plantarum strains (45 of 49 genomes), one Lactobacillus pentosus strain, and two Lactobacillus paraplantarum strains but not in other Lactobacillus species (Fig. S1). This is interesting and hints that adhE may be involved in sorbitol or mannitol metabolism in most L. plantarum strains. There are various gene structures instead of the sorbitol PTS operon downstream of adhE in other Lactobacillus species (see Fig. S2 in the supplemental material). We propose that AdhE may play different roles in these Lactobacillus species. For example, the heterofermentative Lactobacillus fermentum and Lactobacillus buchneri are reported to produce mannitol but do not metabolize this compound as a carbohydrate source (18). This hypothesis is also supported by previous reports that adhE acts differently in Streptococcus pneumoniae, Thermoanaerobacter mathranii, E. coli, etc. (27–30). The functions of AdhE in Lactobacillus still need further research.
It has been reported that the expression of adhE gene is correlated with the ratio of NADH to NAD+ in E. coli (10, 31). Compared with that of glucose, the utilization of sorbitol or mannitol will lead to an NADH burden in cells due to the formation of additional NADH molecules from the reaction catalyzed by mannitol-1-phosphate dehydrogenase (Mtl1PDH) or sorbitol-6-phosphate 2-dehydrogenase (S6PDH) (32). L. plantarum NF92 has complete PTS for sorbitol or mannitol metabolism. We demonstrated that AdhE in L. plantarum NF92 could catalyze the reduction of acetyl coenzyme A (acetyl-CoA) to acetaldehyde (through ALDH) and then to ethanol (through ADH), which is reported to consume two molecules of NADH (NADPH) to NAD+ (NADP+) (33). We propose that AdhE may be upregulated to help consume the accumulated NADH to alleviate the NADH burden. This conclusion is supported by our result that ethanol was produced in L. plantarum NF92 when it utilized sorbitol or mannitol. In addition to production of ethanol, we also found that sorbitol or mannitol was converted mainly to lactic acid and ethanol until 13 h, while later, the increased production of lactic acid was correlated to the consumption of sorbitol or mannitol, and the amount of increased production of ethanol was nearly equal to the amount of acetate consumption (see Table S2 in the supplemental material). Genes coding for acetate kinase and phosphotransacetylase, which can convert acetate to acetyl-CoA, exist in the L. plantarum NF92 genome. We propose that ethanol may be synthesized from acetate by AdhE at the late growth phase to reduce NADH pressure, which is also supported by a report demonstrating that acetate can be used as an electron acceptor to oxidize the additional NADH and produce ethanol by ALDH and ADH during anaerobic sorbitol fermentation in Lactobacillus casei (34). A possible metabolic pathway for sorbitol or mannitol in L. plantarum NF92 is shown in Fig. 7. In the early stage of growth of L. plantarum NF92, sorbitol or mannitol is converted to large amounts of lactic acid and only small amounts of ethanol, and NADH accumulates in the cells. In the later stage of growth, as pyruvate formate-lyase (PFL) may be inactivated by low pH (35), acetate is utilized to accelerate the consumption of NADH through AdhE and increase the ambient pH. When adhE was disrupted, acetate could not be utilized, and the excess intracellular NADH which suppressed the utilization of sorbitol or mannitol accumulated. This could also explain why the production of lactic acid was decreased in the ΔadhE strain.
Proposed pathway of sorbitol or mannitol utilization in L. plantarum NF92. S6PDH, sorbitol-6-phosphate 2-dehydrogenase; Mtl1PDH, mannitol-1-phosphate dehydrogenase; LDH, lactate dehydrogenase; PFL, pyruvate formate-lyase; ACK, acetate kinase; PTA, phosphate acetyltransferase. Red arrows and words show the process of acetate utilization during the later stage of growth. Dashed arrow, pyruvate may not be converted to acetyl-CoA by PFL.
The expression of adhE was verified to be regulated by the activator AcrR and the repressor Rex when L. plantarum NF92 was grown in sorbitol or mannitol. Complex regulation of adhE was also reported in E. coli, as the expression of adhE could be regulated by Cra, Fis, Fnr, NarL, and RopS (12–15). Homologs of these four regulators were searched for, and only Fnr and NarL homologs were found to exist in L. plantarum NF92. EMSA results showed that the Fnr homolog, which was expressed and purified from E. coli, could not bind to PadhE (data not shown). The narL gene from L. plantarum NF92 was also expressed in E. coli; however, we failed to obtain the purified protein after repeated attempts. Moreover, the Fnr- and NarL-binding sites in the adhE promoter in E. coli were not found in PadhE in L. plantarum NF92. We propose that Fnr and NarL in L. plantarum NF92 are not involved in regulating the expression of adhE and that a different regulation mechanism may be present in L. plantarum NF92. AcrR and Rex were screened by an affinity isolation method and shown to be regulators of adhE in L. plantarum NF92.
AcrR belongs to the TetR/AcrR family, which is a large and important family and is widespread among bacteria and archaea (36). AcrR contains a conserved helix-turn-helix DNA-binding domain and a C-terminal ligand regulatory domain and participates in resistance against toxic substances or the production of secondary metabolites (37–39); however, it has not been reported to be related to regulation of sorbitol or mannitol utilization. The regulation of adhE by AcrR has not been reported yet. Here, we showed that AcrR could directly bind to PadhE and acted as an activator to promote the expression of adhE during sorbitol and mannitol utilization in L. plantarum NF92. AcrR was predicted to function as a dimer by homology modeling, and we propose that AcrR may form a dimer to bind to PadhE in L. plantarum NF92. In E. coli, AcrR can recognize and bind to cationic or neutral ligands, resulting in a conformational change that causes AcrR to lose its DNA-binding capacity and then allows for the initiation of downstream gene transcription (40). In L. plantarum NF92, how AcrR receives the metabolic signal and which signal promotes the binding of AcrR to PadhE are still unknown and need further research.
Rex is a global transcription factor and is widely distributed in Firmicutes, Actinobacteria, Thermotogales, and Bacteroidetes (41). The function of the Rex protein in Lactobacillus has not been reported until now. Here, we demonstrate that Rex in L. plantarum NF92 is involved in binding to the adhE promoter and acts as a repressor of adhE. This conclusion is supported by other reports that Rex homologs are also repressors regulating adhE expression in Clostridium acetobutylicum (25, 42), Enterococcus faecalis (43), and Thermoanaerobacterium saccharolyticum (44). Homology modeling showed that Rex in L. plantarum NF92 had a 59.31% sequence identity with B-Rex in Bacillus subtilis (45) and might function as a homodimer. It has been reported that in Thermus aquaticus, when the NADH/NAD+ level is increased, NADH will bind to the C terminus of Rex, leading to a conformational change that will trigger the release of Rex dimer from the binding site of DNA and thereby allowing transcription to proceed (46). The results showed that NADH could cause the dissociation of Rex from the adhE promoter. We propose that Rex may bind to the extra NADH and release the repression of adhE in L. plantarum NF92. According to the results for AcrR and Rex, a model of the regulation of adhE when L. plantarum NF92 utilizes glucose, sorbitol, or mannitol is proposed (Fig. 8).
Proposed model of AdhE regulation during sorbitol or mannitol metabolism in L. plantarum NF92. When L. plantarum NF92 is grown in glucose-containing medium, Rex binds to PadhE and the expression of adhE is repressed. When sorbitol or mannitol is used as the carbon source, much more NADH is formed and accumulates in cells. Excess NADH binds to Rex, causing its release from PadhE and releasing repression of adhE, and then the activator AcrR binds to the same binding site as Rex in PadhE and promotes the expression of adhE. This might be the reason why the transcriptional level of adhE is largely increased when L. plantarum NF92 utilizes sorbitol or mannitol.
In conclusion, in this study we demonstrated that the bifunctional aldehyde-alcohol dehydrogenase-encoding gene adhE in L. plantarum NF92 is responsible for catalyzing the synthesis of ethanol when the strain utilizes mannitol or sorbitol as a carbon source. Mannitol or sorbitol utilization causes the accumulation of NADH, which can be consumed by the synthesis of ethanol catalyzed by AdhE. In the later stage of L. plantarum NF92 growth, acetate is also utilized to accelerate the consumption of NADH through AdhE and increases the ambient pH. Two transcriptional factors, AcrR and Rex, were verified to bind to similar binding sites in the adhE promoter and regulate the expression of adhE. We propose that adhE may be cross-regulated by the activator AcrR and the repressor Rex when L. plantarum NF92 utilizes sorbitol or mannitol. The cross-regulation of adhE by AcrR and Rex is important to balance the level of NADH in the cell during sorbitol or mannitol utilization in L. plantarum NF92.
MATERIALS AND METHODS
Bacterial strains and growth conditions.The bacterial strains used in this study are shown in Table 3. All E. coli strains were grown in Luria broth (LB) with aeration at 37°C. L. plantarum NF92 and its derivatives were routinely grown in De Man-Rogosa-Sharp (MRS) medium at 30°C. Flask fermentation or transcriptional analysis was conducted in MRS (2% glucose), MRSD (2% d-ribose), MRSM (2% mannitol), or MRSS (2% sorbitol) medium. Chloramphenicol was used at 20 μg/ml for E. coli and 15 μg/ml for L. plantarum NF92.
Strains and plasmids used
Plasmids and strain construction.The plasmids used in this study are shown in Table 3. The L. plantarum NF92 genome was used as the template to PCR amplify and clone adhE, lysR, acrR, or rex, and these genes were inserted into pET28a by standard molecular biology techniques, generating expression vectors pET28a-adhE, pET28a-lysR, pET28a-acrR, and pET28a-rex. Protein expression strains E. coli (adhE), E. coli (lysR), E. coli (acrR), and E. coli (rex) were generated by transforming these plasmids into E. coli BL21, respectively.
Strains with disruptions in adhE or acrR were constructed by using a double-crossover strategy with plasmid pMG36c (MK). DNA sequences containing homologous arms and resistance genes were obtained by fusion PCR and cloned into pMG36c (MK), and then the knockout plasmids were introduced into L. plantarum NF92 by electroporation as previously described (47) with the modification that MRS was supplemented with 2% glycine. Knockout strains were obtained by continuous culturing and further confirmed by PCR analysis and DNA sequencing. Complemented strains were obtained by inserting the adhE or acrR gene into pMG36c (M) or pMG36c (MK) and transforming into the knockout strains. Overexpression strains were generated by inserting the acrR or rex gene into pMG36c (M) and transforming into L. plantarum NF92. All plasmids for transformation of L. plantarum NF92 were obtained from E. coli DH5α. Primers used in this study are shown in Table 4.
Primers
Protein expression and purification.Overnight cultures of E. coli (adhE), E. coli (lysR), E. coli (acrR), and E. coli (rex) were inoculated in LB with 50 μg/ml kanamycin at 1% (vol/vol) and grown aerobically to an optical density at 600 nm (OD600) of 0.6 to 0.8. The cultures were induced with 0.5 mM IPTG (isopropyl-β-d-thiogalactopyranoside) and incubated at 18°C for 20 h. Proteins were purified on immobilized metal affinity chromatography (IMAC) Ni2+ column (GE Healthcare Life Science) and confirmed by SDS-PAGE. For AdhE, a HiTrap desalting column (GE Healthcare, Sweden) was utilized to remove any imidazole present in the elution buffer, and the protein was dissolved in storage buffer (50 mM phosphate buffer, 0.1 mM dithiothreitol [DTT], 300 mM NaCl, 5% glycerol, pH 7.0). The concentrations of protein were quantified by using Pierce bicinchoninic acid (BCA) protein assay kit (Thermo Scientific, USA).
Enzyme assays.To assess the physiological role of AdhE, all reaction assays were carried out at pH 7.0 and 30°C in 50 mM phosphate buffer. Reduction of acetyl-CoA was assayed with 0.1 mM acetyl-CoA, 0.01 to 0.4 mM NADH, and 0.5 μM FeSO4 in an assay buffer of 50 mM phosphate (pH 7.0). Oxidation of ethanol was assayed with 0.5 M ethanol, 1 mM coenzyme A, and 0.2 to 24 mM NAD+ in the same assay buffer. The change in absorbance at 340 nm caused by NADH oxidation or reduction was monitored with a Beckman DU800 spectrophotometer. Kinetic constants were calculated by fitting the data to the Michaelis-Menten equation utilizing GraphPad Prism 7.0 software (GraphPad Software, CA, USA).
Detection of the metabolic products before or after adhE mutation.In order to identify the function of AdhE in L. plantarum NF92, the contents of sugars, ethanol, lactic acid, and acetate in the cultures were detected by high-pressure liquid chromatography (HPLC). Three duplicate fermentations were carried out in different media (MRS, MRSM, or MRSS) for the WT strain, the adhE knockout strain, and the complemented strain. Samples were taken at time points from 0 to 60 h of fermentation. The HPLC system was equipped with an Agilent 1200 RID detector (Agilent Technologies, USA) which was maintained at 50°C. An Aminex HPX-87H column (Bio-Rad Laboratories, Richmond, CA, USA) was maintained at 60°C, and the mobile phase (0.005 mol/liter H2SO4) was used at a flow rate of 0.6 ml/min. Standard curves were obtained by gradient dilution of standards.
Isolation and identification of PadhE-binding protein.The method for isolation and identification of PadhE-binding protein was that of Mao et al. (48) with some modifications. The biotinylated vector and vector-PadhE were prepared by PCR from pESAY-Blunt and pESAY-Blunt-PadhE, respectively. L. plantarum NF92 cells were cultured to logarithmic phase in MRSS or MRSM and lysed with a French pressure cell. After LC-MS/MS, DNA-binding proteins were identified according to the standards that the peptide expected value was <0.01, more than two peptide fragments were identified, and there were DNA-binding domains in these proteins. The binding of regulators to PadhE was analyzed by electrophoretic mobility shift assay (EMSA).
EMSA and DNase I footprinting.EMSA was performed as described previously (49–51). The PadhE DNA probe was amplified by PCR from the genomic DNA of L. plantarum NF92. PadhE (20 ng) was incubated with increasing concentrations of AcrR or Rex at 25°C for 20 min in a 20-μl reaction mixture, and 1 μg salmon sperm DNA was used as competing DNA. Samples were loaded on 4% (wt/vol) nondenaturing polyacrylamide gels, and electrophoresis was performed on ice. After electrophoresis, the gel containing DNA was stained with SYBR gold nucleic acid gel stain (Thermo Scientific, USA) for 50 min and photographed under UV transillumination.
DNase I footprinting assays were performed according to the method reported by Zianni et al. (52). Briefly, DNA fragments were obtained by PCR using fluorescently labeled primers FAM-PadhE-F [5′-(6-carboxyfluorescien)-TCAAGACTCGGGACAGGGATTAAG-3′] and HEX-PadhE-R [5′-(6-carboxy-2,4,4,5,7,7-hexachlorofluorescein)-GAAGTGCTTCCTCCGTTCAATTC-3′] and purified from the agarose gel with a DNA recovery kit. The probe was incubated at 25°C for 20 min with different concentrations of protein in a 50-μl reaction volume, the mixture was digested with DNase I (Thermo Scientific, USA) at 37°C for 30 s, and the reaction was stopped with EDTA. The DNA fragment was purified with a GeneJET gel extraction kit (Thermo Scientific, USA) and sequenced by Sino Geno Max Co. The results were further analyzed by GeneMarker v 2.2.0. For confirmation of the binding sites, two 41-bp binding sequences from the PadhE intergenic region were inserted into fragment A (FA) of the 16S rRNA gene, generating fragment B (FB) and fragment C (FC). Their ability to bind with AcrR or Rex was determined by EMSA.
qRT-PCR analysis.The transcriptional level of adhE was analyzed by real-time quantitative RT-PCR (qRT-PCR). Cells of Lactobacillus plantarum NF92 were cultured in MRS, MRSS, or MRSM medium and harvested in logarithmic phase. Total RNAs were extracted and purified using the bacterial RNA kit (Omega) according to the protocol provided by the manufacturer. Reverse transcription of RNA to cDNA was carried out with a RevertAid first-strand cDNA synthesis kit (Thermo Scientific). The synthesized cDNA was used as the template for the target gene (AdhE-coding gene) and internal control (16S rRNA-coding gene) (53). As a negative control, H2O was used as the template. qRT-PCR was performed in a Roche LC480 and 2× SYBR green mix kit (Kapa) according to the manufacturer’s instructions. Abs Quant/2nd Derivative Max was used to calculate the crossing point (Cp) value. Primers used in this study are displayed in Table 4.
Accession number(s).This Whole Genome Shotgun project on L. plantarum NF92 has been deposited at DDBJ/ENA/GenBank under accession number RDQI00000000 (https://www.ncbi.nlm.nih.gov/nuccore/RDQI00000000).
ACKNOWLEDGMENTS
This work was supported by grants from the National Natural Science Foundation of China (31570114), the Special Fund for Agro-scientific Research in the Public Interest (201503134), and the Science and Technology Service Network Initiative of the Chinese Academy of Sciences (KFJ-STS-ZDTP-004-2-2).
Kunling Teng and Jin Zhong were involved in the conception and design of the study and in revising the manuscript; Xiaopan Yang and Kunling Teng were involved in drafting the manuscript; Xiaopan Yang, Rina Su, and Lili Li were involved in the acquisition, analysis, and interpretation of the data; Tong Zhang and Jie Zhang were involved in screening L. plantarum NF92 from fermented grains; and Keqiang Fan was involved in analyzing the distribution of adhE in Lactobacillus genomes. All of the authors discussed the results and reviewed the manuscript.
FOOTNOTES
- Received 21 August 2018.
- Accepted 28 November 2018.
- Accepted manuscript posted online 7 December 2018.
Supplemental material for this article may be found at https://doi.org/10.1128/AEM.02035-18.
- Copyright © 2019 American Society for Microbiology.
