Table 2.

Theoretical alignment of sequences of amplimers 63f and 1387r with database sequences of 16S rRNA genes from species not tested by PCR

StrainWoese groupingSequence vsa:
63f1387r
CAGGCCTAACACATGCA—AGTCCGGAACATGTGWGGCGGG
Fibrobacter intestinalesFibrobacterspp.AGTGTCTTATACATGCA—AGTCGCCTTGTACACACCGCCC
Chlorobium limicolaGreen non-sulfurCGTGCCTAACACATGCA—AGTCGCCTTGTACACACCGCCC
Chloroflexus aurantiacusGreen non-sulfurCGTGCCTAATGCATGCA—AGTCGCCTTGTACACACCGCCC
Herpetosiphon aurantiacusGreen non-sulfurCGTGCCTAATGCATGCA—AGTCGCCTTGTACACACCGCCC
Thermomicrobium roseumGreen non-sulfurCGTGCCTAATGCATGCA—AGTCGCCTTGTACACACCGCCC
Deinococcus radioduransRadioresistant micrococci and relativesCGTGCTTAAGACATGCA—AGTCGCCTTGTACACACCGCCC
Thermus aquaticusRadioresistant micrococci and relativesCGTGCCTAAGACATGCA—AGTCGCCTTGTACACACCGCCC
Thermus ruberRadioresistant micrococci and relativesTATGCCTAAGACATGCA—AGTCGCCTTGTACACACCGCCC
Fervidobacterium nodosumThermotogalesCGTGCCTAACACATGCA—AGTCGCCTTGTACACACCGCCC
Thermotoga elfiiThermotogalesCGTGCTTAACACATGCA—AGTCGGTTTGCACACACCGCCC
Thermotoga maritimaThermotogalesCGTGCCTAACACATGCA—AGTCGCCTTGTACACACCGCCC
  • a Nucleotides underlined and in boldface differ from corresponding nucleotides in amplimer.