Table 3.

Alignment of sequences of amplimers 63f-1387r and 27f-1392r with the corresponding regions of 16S rDNA genes of representative species used in PCR

StrainWoese groupSequence vs primersa:
27f and 63f1387r and 1392r
AGAGTTTGATCMTGGCTCb            CAGGCCTAACACATGCAA—GTCc     CRTGTGTGGCGGGCAd
CGGAACATGTGMGGCGGGe
Rhodobacter sphaeroides ATH 2.4.1α-Proteobacteria GAGAGTTTGATCCTGGCTCAGAATGAACGCTGGCGGCAGGCCTAACACATGCAA—GTC GCCTTGTACACACCGCCCGT
Alcaligenes eutrophus β-Proteobacteria AAGAGTTTGATCCTGGCTCAGATTnAACGCTGGCGGCA T GCCT T ACACATGCAA—GTC G T CTTGTACACACCGCCCGT
Campylobacter concisus (FDC 288)ɛ-Proteobacteria GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGTGGC GT GCCTAA T ACATGCAA—GTC G T CTTGTAC T CACCGCCCGT
Campylobacter curvus (ATCC 35224T; VPI 9584)ɛ-Proteobacteria GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA—GTC G T CTTGTAC T CACNGCCCGT
Campylobacter rectus (CCUG 19168)ɛ-Proteobacteria GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA—GTC G T CTTGTAC T CACCGCCCGT
Campylobacter showae (CCUG 3054)ɛ-Proteobacteria GAGAGTTTGATCCTGGCTCAGAGTGAACGCTGGCGGC GT GCCTAA T ACATGCAA—GTC G T CTTGTAC T CACCGCCCGT
Desulfobacter postgatei δ-Proteobacteria GAGAGTTTGATCCTGGCTCAGAATGAACGCTGGCGGC GT GC T TAACACATGCAA—GTC GNNTTGTACACACCGCCNGT
Desulfovibrio desulfuricans (ATCC 27774)δ-Proteobacteria GAGAGTNTGAT T CTGGCTCAGATTGAACGCTGGCGGC GT GC T TAACACATGCAA—GTC GCCTTGTACACACCGCCCGT
Myxococcus xanthus DK1622 (ATCC null)δ-Proteobacteria GAGAGTTTGATCCTGGCTCAGAACGAACGCTGGCGGC GT GCCTAACACATGCAA—GTC GCCTTGTACACACCGCCCGT
Acinetobacter calcoaceticus γ-Proteobacteria AAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGC T TAACACATGCAA—GTC GCCTTGTACACACCGCCCGT
Escherichia coli γ-Proteobacteria AAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAA—GTC CCTTGTACACACCGCCCGTC
Pseudoramibacter alactolyticus DSM 3980, ATCC 23263γ-Proteobacteria -AGAGTTTGAT Y MTGGCTCAGGACGAACGCTGGCGG T A T GC T TAACACATGCAA—GTC G T CTTGTACACACCGCCCGT
Bacillus cereus F4810/72 serotype 1 (NCTC 11143) Bacillus-Lactobacillus-Streptococcussubdivision GAGAGTTTGATCCTGGCTCAGGATGAACGCTGGCGGC GT GCCTAA T ACATGCAA—GTC GCCTTGTACACACCGCCCGT
Bacillus popilliae Bacillus-Lactobacillus-Streptococcussubdivision GAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGC GT GCCTAA G ACATGCAA—GTC G T CTTGTACACACCGCCCGT
Lactobacillus coryniformis Bacillus-Lactobacillus-Streptococcussubdivision GAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGC GT GCCTAA T ACATGCAA—GTC GCCTTGTACACACCGCNCGT
Lactobacillus delbrueckii subsp. delbrueckii strain Calvert Bacillus-Lactobacillus-Streptococcussubdivision GAGAGTTNGATCCTGGCTCAGGACGAACGCTGGCGGC GT GCCTAA T ACATGCAA—GTC GCCTTGTACACACCGCCCGT
Streptococcus salivarius C699 (ATCC 13419) Bacillus-Lactobacillus-Streptococcussubdivision GAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGC GT GCCTAA T ACATGCAA—GT A GCNTNGTACACACCGCCCGT
Streptococcus sanguis (NCTC 7863; ATCC 15300) Bacillus-Lactobacillus-Streptococcussubdivision GAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGC GT GCCTAA T NCNTGCAA—GTN GCCTTGTACACACCGCCCGT
Eubacterium angustum Clostridia and relatives GAGAGTTTGATCCTGGCTCAGGATGAACGCTGGCGGC GT GC T TAACACATGCAA—GTC G T CTTGTACACACCGCCCGT
Eubacterium fossor Clostridia and relatives GAGAGTT C GATCCTGGCTCAGGATGAACGCTGGCGGC GC GCCTAACACATGCAA—GTC GCNTTGTACACACCGCCCGT
Eubacterium lentum Clostridia and relatives -AGAGTTTGATNNTGGCTCAGGATGAACGCTGGCGGC GT GCCTAACACATGCAA—GTC GCCTTGTACACACCGCCCGT
Eubacterium limosum Clostridia and relatives GAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGG T A T GC T TAACACATGCAA—GTC G T CTTGTACACACCGCCCGT
Eubacterium xylanophilum Clostridia and relatives GAGAGTTTGATCCTGGCTCAGGATGAACGCTGGCGGC GT GC T TAACACATGCAA—GTC G T CTTGTACACACCGCNCGT
Nostoc muscorum Cyanobacteria and chloroplasts GAGAGTTTGATCCTGGCTCAGGATGAACGCTGGCGG T A T GC T TAACACATGCAA—GTC GCCTTGTACACACCGCCCGT
Prevotella buccalis Flexibacter-Cytophaga-Bacteroidesphylum TAGAGTTTGATCCTGGCTCAGGATNAACGCTAGCTACAGGC T TAACACATGCAA—GTC GCCTTGTACACACCGCCCGT
Prevotella intermedia Flexibacter-Cytophaga-Bacteroidesphylum GAGAGTTTGATCCTGGCTCAGGATNAACGCTAGCTA T AGGC T TAACACATGCAA—GTC GCCTTGTACACACCGCCCGT
Prevotella oris Flexibacter-Cytophaga-Bacteroidesphylum GAGAGTTTGATCCTGGCTCAGGATNAACGCTGGCTACAGGC T TAACACATGCAA—GTC GCCTTGTACACACCGCCCGT
Prevotella veroralis Flexibacter-Cytophaga-Bacteroidesphylum GAGAGTTTGATCCTGGCTCAGGATNAACGCTAGCTACAGGC T TAACACATGCAA—GTC GCCTTGTACACACCGCCCGT
Actinomyces viscosus Gram positive, high G+C GAGAGTTNNATCCTGGCTCAGGACGAANGCTNGCGGC GT GC T TAACACATGCAA—GTC GGCTTGTACACACCGCCCGT
Propionibacterium acnes Gram positive, high G+C GAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGC GT GC T TAACACATGCAA—GTC G T CTTGTACACACCGCCCGT
Chlamydia psittaci Planctomyces and relatives GAGA A TTTGATC T TGG T TCAGATTGAACGCTGGCGGC GT G GA T G A GG CATGCAA—GTC GCCTTGTACACACCGCCCGT
Leptospira inadai ATCC 43289 Spirochaeta-Treponema-Borreliasubdivision ???????????????????????STARCGTTGGCGGC GCGT C TT A A ACATGCAA—GTC A CCTTGTACACACCGCCCGT
Leptospira kirschneri ATCC 23469 Spirochaeta-Treponema-Borreliasubdivision ???????????????????????STARCGCTGGCGGC GCGT C TT A A ACAT T C CA AGTC A CCTTGTACACACCGCCCGT
Leptospira wolbachii ATCC 43284 Spirochaeta-Treponema-Borreliasubdivision ???????????????????????STARCGCTGGCGGC GCGT C TT A A ACATGCA—A C TC A CCTTGTACACACCGCCCGT
Treponema denticola Spirochaeta-Treponema-Borreliasubdivision GAGAGTTTGATCCTGGCTCAGAACGAACGCTGGCGGC GC G T CT T AA G CATGCAA—GTC GCCTTGTACACACCGCCCGT
Treponema phagedenis Spirochaeta-Treponema-Borreliasubdivision GAGAGTTTGATCCTGGCTCAGAACGAACGCTGGCGGC GC G T CT T AA G CATGCAA—GTC GCCTTGTACACACCGCCCGT
  • a Primer sequences are written 5′→3′. Sequence data on listed species were obtained from the Antwerp ribosomal database. Nucleotides underlined and in boldface differ from corresponding nucleotides in amplimer.

  • b Amplimer 27f sequence.

  • c Amplimer 63f sequence.

  • d Amplimer 1387r sequence.

  • e Amplimer 1392r sequence.