TABLE 3

Primers used in this study

PrimerSequencePurpose
dest-FWDTAGGGATAACAGGGTAATCAGTCGTGTCATCTGATTACCTGGCGGAAATTAAACTAAGAGAGAGCTCTAAATCATGAAAAATTTATTTGCTTTGTGConstruction of pET30a-dest
dest-REVCGAATTAGCCTGCCAGCCCTGTTTTTATTAGTGCATTTTGCGCGAGGTCAAAATAAATTTTTCATGATTTConstruction of pET30a-dest
I-SceI-LP-T5-FWDTCCGATTAGGGATAACAGGGTAATGTGTAGGCTGGAGCTGCTTCTACGGCCCCAAGGTCCAAACGGTGAAAATCATGAAAAATTTATTTGCTTTGTGConstruction of pET30a-LP-pcaIJFK, pET30a-LP-control
LP-IJFK-REVACAAGGCCATGGCTGATCATATGAATATCCTCCTTAGTTGGCTTCAGGGATGAGGCGCCATCCTGGGCGGTTCTGATAACGAConstruction of pET30a-LP-pcaIJFK
LP-HGBDC-REVACAAGGCCATGGCTGATCATATGAATATCCTCCTTAGTTGGCTTCAGGGATGAGGCGCCATCTTTGCCTGGCGGCAGTAGConstruction of pET30a-LP-pcaHGBDC
LP-control-REVACAAGGCCATGGCTGATCATATGAATATCCTCCTTAGTTGGCTTCAGGGATGAGGCGCCATCAAATAAATTTTTCATGATTTConstruction of pET30a-LP-control
ompT-LP-upATATAAAAAATACATATTCAATCATTAAAACGATTGAATGGAGAACTTTTCATATGAATATCCTCCTTAGTTGGCTTCAGI-SceI, landing pad and CmR cassette integration at ompT
ompT-LP-downAGTTATTCCCCGGGGCGATTTTCACCTCGGGGAAATTTTAGTTGGCGTTCGTGTAGGCTGGAGCTGCTTCI-SceI, landing pad and CmR cassette integration at ompT
pflB-LP-upTTTTACTGTACGATTTCAGTCAAATCTAATTACATAGATTGAGTGAAGGTGTGTAGGCTGGAGCTGCTTCI-SceI, landing pad and CmR cassette integration at pflB
pflB-LP-downCGAAGTACGCAGTAAATAAAAAATCCACTTAAGAAGGTAGGTGTTACATGCATATGAATATCCTCCTTAGI-SceI, landing pad and CmR cassette integration at pflB
ompT-FWDTAAACAAAATATAAACAGTGGAGCPCR screen at ompT
ompT-REVCTATAATTGATGGTTTTCTATGTGPCR screen at ompT
pflB-FWDTTTTACTGTACGATTTCAGTCAAATPCR screen at pflB
pflB-REVCGAAGTACGCAGTAAATAAAAAATCPCR screen at pflB
pTarget FWDGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGInverse PCR of pTarget
pTarget REVACTAGTATTATACCTAGGACTGAGInverse PCR of pTarget
elfC N20FTTCCTTATGCCACTTCTTATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCConstruction of elfC sgRNA
elfC N20RATAAGAAGTGGCATAAGGAAACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAGGATCConstruction of elfC sgRNA
pcaH N20F1TTTTACCTCCTCTCTAGAAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCConstruction of pcaH sgRNA
pcaH N20R1CTTCTAGAGAGGAGGTAAAAACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAGGATCConstruction of pcaH sgRNA
pcaH N20F2AGAGGAGGTAAAACATATGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCConstruction of pcaH sgRNA
pcaH N20R2GCATATGTTTTACCTCCTCTACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAGGATCConstruction of pcaH sgRNA
flu N20FTACGAACTTCCCTGTGCGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCConstruction of flu sgRNA
flu N20RCCCGCACAGGGAAGTTCGTAACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAGGATCConstruction of flu sgRNA