TABLE 2

Primers and probes used in this studya

Primer namePlatformSpecificitySequence (5′ to 3′)Product size (bp)Reference or sourceNotes
F- CCHF S1RT-PCRCCHFV S segmentTCTCAAAGAAACACGTGCC12271
R- CCHF S122CCTTTTTGAACTCTTCAAACC
Probe(FAM)ACTCAAGGKAACACTGTGGGCGTAAG(BHQ1)
NC-Fran16S-FPCRFLE 16S rRNA geneCAACATTCTGGACCGAT37333Used for screening, 40 cycles for egg samples and 35 cycles for others
NC-Fran16S-RTGCGGGACTTAACCCAACAT
NC-Fran16S-FFLE 16S rRNA gene and universal primer 16S rRNACAACATTCTGGACCGAT72833Used for phylogeny with R1494 under same conditions as screening the PCR
R1494CTACGGCTACCTTGTTACGA30
Rr190.70FRickettsial OmpA-encoding geneATGGCGAATATTTCTCCAAAA63072Extension for 1 min at 72°C
Rr190.701RGTTCCGTTAATGGCAGCATCT
TY-J-14495′ region of COIAATTTACAGTTTATCGCCT86073Used to obtain consensus sequences
C1-N-2312CATACAATAAAGCCTAATA
HCO20645′ region of COIGGTGGGCTCATACAATAAATCC86073Used for restriction analyses
HCO1215GCCATTTTACCGCGATGA
/Cy5/Eub338FISHBacterial 16S rRNAGCTGCCTCCCGTAGGAGT74
/Cy3/anti-sense Eub338No bacterial detectionACTCCTACGGGAGGCAGC74
/Cy3/FLEFLE 16S rRNAACTCCAACAGCTAGTACTCAThis study
  • a FAM, 6-carboxyfluorescein; BHQ1, black hole quencher 1; FISH, fluorescence in situ hybridization.