TABLE 2

List of primers used in this study

Primer purposeaRegionPrimer nameSequence (5′ to 3′)Expected product length (kbp)
Cotranscription analysis overlapping RT-PCRgbp-glcFGBP RT FCATGGACATGAGCAAGTTCG0.69
GlcF RT RGCCATGGGGTACAGGTAGAC
glcF-glcGGlcF RT FTCCTGTCCTTCACCAACTCC1.21
GlcG RT RAGGCCGTAGACGATATGCAC
glcG-glcKGlcG RT FGTGTTGATCTCGACCCTGCT0.85
GlcK RT RGGACTGGAAGACCATGGCGA
glcK-oprBGlcK OL FCGATGTGATCCTTGGCATTCG0.7
OprB OL RGGTGATTGCCAGCTTGAACTCG
gbp-glcGGBP RT FCATGGACATGAGCAAGTTCG1.67
GlcG RT RAGGCCGTAGACGATATGCAC
glcF-glcKGlcF RT FTCCTGTCCTTCACCAACTCC1.86
GlcK RT RGGACTGGAAGACCATGGCGA
glcG-oprBGlcG RT FGTGTTGATCTCGACCCTGCT2.13
OprB OL RGGTGATTGCCAGCTTGAACTCG
benK-catAPolycis BenKCATTCTCGGTGGCTGGCTG0.96
Polycis catAGAATAGGTGCCCTGGGTGTTGG
catA-benEcatAFTATCGTCACCGACGCCGAAG1.49
BenE RCGATCAACTCTGCCGGAAAG
benE-benFBenE FCCGATCATCAGCAGCAGTG1.45
BenF RATGGCCTGGTAGCCGATGTAG
qPCRgbpGBP RT FCATGGACATGAGCAAGTTCG0.151
GBP RT RGTTGGTCACCACATCGAAGA
glcGGlcG RT FGTGTTGATCTCGACCCTGCT0.209
GlcG RT RAGGCCGTAGACGATATGCAC
oprBOprB RT FAACGACGACGTGAAGAAACG0.234
OprB RT RCGAGCTCTGCACCTTGATCC
rpoDrpoD RT FGACAGTGACGACGAAGACGA0.155
rpoD RT RTCACGACCATGCTTCTTGAG
benKBenKqRT FCATCCCGTTGTTGCTGCTG0.170
BenKqRT RCCTTGCCCTTGTTGTCGTG
benEBenEqRT FGTTGTCCCACGAGTTGCTGTC0.230
BenEqRT RCGAAGGCACCGCTCAGG
Cloning GlcKglcKbABC exp FCGCGGATCCCATATGGCAACGCTCGAACTTCG1.155
ABC new RCCGCTCGAGTCAACGCCCTTTGAACTGC
  • a RT-PCR, reverse transcriptase PCR; qPCR, quantitative real-time PCR.

  • b Restriction sites in forward (BamHI) and reverse (XhoI) are underlined.