TABLE 4

Primers for 81-176 poly(G)-containing genes

GeneNCTC11168 homologaPrimerPrimer sequence
CJJ81176_0082Cj0044c81176-0082-fwdGGTTTTACACTAGAACACAGAAG
81176-0082-fwd-FAMFAM-GGTTTTACACTAGAACACAGAAG
81176-0082-revCCATACACGAAGAACTTGTTAGCAA
CJJ81176_0086NA81176-0086-fwdGCACAAGCTACAAATTTAGAAGTG
81176-0086-fwd-FAMFAM-GCACAAGCTACAAATTTAGAAGTG
81176-0086-revAAGTAGAAGCATTAGGCGTGGAT
CJJ81176_0206Cj017181176-0206-fwdTGTTGTGGAAATGGAGTGCATTC
81176-0206-fwd-NEDTGGTTGTGGAAATGGAGTGCATTC
81176-0206-revAATAGCTCCTTCATTGCATAGTTC
CJJ81176_0590Cj056581176-0590-fwdGCTATAGTGTTGATGTGTAGTTTGT
81176-0590-fwd-FAMFAM-GCTATAGTGTTGATGTGTAGTTTGT
81176-0590-revCCTTTATCAATTTCTATTCTTAGAC
CJJ81176_0646Cj061781176-0646-fwdTGGTATAATGCAAGCTATGG
81176-0646-fwd-VICTGGTATAATGCAAGCTATGG
81176-0646-revAAATCAATACTCCAAGGAGC
CJJ81176_0708Cj068581176-0708-fwdGATAGCGAATATAACCTCTAAATTC
81176-0708-fwd-FAMFAM-GATAGCGAATATAACCTCTAAATTC
81176-0708-revGAAGAAATCCGCCAATCAAAGGCC
CJJ81176_0758Cj073581176-0758-fwdGCAAACCAAGCATAGGGGATTGTGG
81176-0758-fwd-FAMFAM-GCAAACCAAGCATAGGGGATTGTGG
81176-0758-revTTCACCATCAAAAGCTACAGATCCTG
CJJ81176_0765NA81176-0765-fwdTGCAAGAGCTGTTCATCGGTTTAAAC
81176-0765-fwd-NEDTGCAAGAGCTGTTCATCGGTTTAAAC
81176-0765-revCTTAAAAGGGGATTAAATAAAGGAT
CJJ81176_1160Cj114381176-1160-fwdCGATGCCAAGAAGCTTTATAAGAGTT
81176-1160-fwd-FAMFAM-CGATGCCAAGAAGCTTTATAAGAGTT
81176-1160-revGCTTGTAGTATTTTCACTCCTTGAGAT
CJJ81176_1312Cj129581176-1312-fwdTTCCTATCCCTAGGAGTATC
81176-1312-fwd-NEDTTCCTATCCCTAGGAGTATC
81176-1312-revATAGGCTTCTTTAGCGTTCC
CJJ81176_1321Cj1305c81176-1321-27-fwdCAACTTTTATCCCACCTAATGGAG
81176-1321-27-fwd-VICCAACTTTTATCCCACCTAATGGAG
81176-1321-revGTGGAAAATCTTCATAATATTCACTG
CJJ81176_1325NA81176-1325-fwdGCTTGATGATAATTTTACCGCCTTAAG
81176-1325-revCAATCTAGCCTTAGGCACTCCGATT
CJJ81176_1327NA81176-1325-fwd-FAMFAM-GCTTGATGATAATTTTACCGCCTTAAG
81176-1327-revTCTCAATAACGGCAAAACAGTTCCC
CJJ81176_1341Cj134281176-1341-fwdGGTAATCGTCCTCAAACAGG
81176-1341-fwd-FAMFAM-GGTAATCGTCCTCAAACAGG
81176-1341-revGCCAAATGCGCTAAATATCC
CJJ81176_1419Cj1420c81176-1419-fwdGCTAGTTCTTTCCATTGGAC
81176-1419-fwd-FAMFAM-GCTAGTTCTTTCCATTGGAC
81176-1419-revTGCCACTGCTTACACGAGCAAG
CJJ81176_1421Cj1422c81176-1421-35-revTTGAGCTGAGGAAAGATTTGTATAG
81176-1421-fwdTATTGGTGTGCCTGAGGATTATTAT
81176-1421-fwd-VICTATTGGTGTGCCTGAGGATTATTAT
CJJ81176_1429Cj1429c81176-1429-fwdCTCCTATTCTTTCAGAACGTGATAT
81176-1429-fwd-FAMFAM-CTCCTATTCTTTCAGAACGTGATAT
81176-1429-revCTATGCTAGCATCATATTCAATTACC
CJJ81176_1432Cj113881176-1432-fwdCTAGGACAGGCTTTGATTATAAATTC
81176-1432-fwd-VICCTAGGACAGGCTTTGATTATAAATTC
81176-1432-revCACCATCATCTCTAACAGATATAAAT
CJJ81176_1435NA81176-1435-fwdATCTTAATACCTGATTTTATCAAAAC
81176-1435-fwd-NEDATCTTAATACCTGATTTTATCAAAAC
  • a NA, not applicable (no homolog in NCTC11168).