TABLE 3

Oligonucleotide primers used for plasmid construction

PrimerNucleotide sequenceaTarget protein
gfp-FCACACAGGAAACAGCTATGAGTAAAGGAGAAGAACGFP
gfp-RTAACAAAATATTAACGCTTATTTGTATAGTTCATACAT
phoA-FCACACAGGAAACAGCTATGCGGGCACCAGAAATGCPhoA
phoA-RTATTTGTACAAAATATTAACGCTTATTTCAGCCCCAGAGCG
Signal-phoA-FCACACAGGAAACAGCTATGAAACAAAGCACTATTGCACSignal-PhoA
Cpsqr-FCACACAGGAAACAGCTATGCAACCCCGCGCCCTCACCCpSQR
Cpsqr-RAACAAAATATTAACGCTTATCCCTGCAACTCGGGT
Cpsqr-phoA-R TCCTGCTGCACTTCCTGCACTTCCTCCCTGCAACTCGGGTGCpSQR-linker
Cpsqr-phoA-F CAGCAGGAAGTGGAGAATTCCGGGCACCAGAAATGCCTGLinker-PhoA
Cpsqr-gfp-F CAGCAGGAAGTGGAGAATTCATGAGTAAAGGAGAAGAACTLinker-GFP
Cpduf-gfp-R TGCTGCACTTCCTGCACTTCCTAGATCATAGCCGGCGGCCCpDUF442-linker
Linker-F GGAAGTGCAGGAAGTGCAGCAGGAAGTG Linker-PhoA/GFP
Fragment26-phoA-R TTCCTGCTGCACTTCCTGCACTTCCGGCCGCCAGAGCGTGCFragmentR6-linker
Fragment49-phoA-R TCCTGCTGCACTTCCTGCACTTCCTTCCTGGAAGTTTGGCTFragment49-linker
Fragment71-phoA-R TTCCTGCTGCACTTCCTGCACTTCCGACCTTGCCCGATTCCFragment71-linker
Fragment83-phoA-R CCTGCTGCACTTCCTGCACTTCCCAGGAGTTGGCCGAACGFragment83-linker
Fragment106-phoA-R TTCCTGCTGCACTTCCTGCACTTCCCAGCGCCCACAGCGTCFragment106-linker
Fragment115-phoA-R CCTGCTGCACTTCCTGCACTTCCCGGCAGTGGCCTGATCACFragment115-linker
Fragment157-phoA-R TTCCTGCTGCACTTCCTGCACTTCCGCCGCCAATGATGACCFragment157-linker
Fragment176-phoA-R CTTCCTGCTGCACTTCCTGCACTTCCATCCAGCCCCGGCFragment176-linker
Fragment230-phoA-R CTTCCTGCTGCACTTCCTGCACTTCCCTCGGGCTCGAAGGFragment230-linker
Fragment359-phoA-R CTTCCTGCTGCACTTCCTGCACTTCCGACGTACTGCATCAFragment359-linker
Fragment450-phoA-R CTTCCTGCTGCACTTCCTGCACTTCCGTTGCCGGCGTCGCFragment450-linker
tolB-phoA-FCACACAGGAAACAGCTATGAAGCAGGCATTACGAGTolB-linker
tolB-phoA-R CCTGCTGCACTTCCTGCACTTCCCAGATACGGCGACCAGG
mhpT-gfp-FCACACAGGAAACAGCTATGTCGACTCGTACCCCTTMhpT-linker
mhpT-gfp-R TGCTGCACTTCCTGCACTTCCGGCATCGGCGCACGGCTGTA
Cppdo1-gfp-FACACAGGAAACAGCTATGCAAACCTTCTATCpPDO1-linker
Cppdo1-gfp-R ACTTCCTGCACTTCCGGCGCCATGCGGCACG
Cppdo2-gfp-FCACACAGGAAACAGCTATGACACCGACCATGCCAAGCpPDO2-linker
Cppdo2-gfp-R TGCTGCACTTCCTGCACTTCCGAGGGCGTTGAGGGGAATCT
Papdo2-gfp-FACACAGGAAACAGCTATGTTGAAACCCGACPaPDO2-linker
Papdo2-gfp-R TGCACTTCCTGCACTTCCGAACAGATCCAGCGGGA
Atblh-gfp-FACACAGGAAACAGCTATGAAGGCCGTAAGGAtBlh-linker
Atblh-gfp-R ACTTCCTGCACTTCCCCATGTGCTGCCCTCCAG
Mxpdo1a-gfp-FACACAGGAAACAGCTATGCTCTTCCGCCAGMxPDO1a-linker
Mxpdo1a-gfp-R ACTTCCTGCACTTCCATGTGTGAAGCTGCCTC
gloB-gfp-FACACAGGAAACAGCTATGAATCTTAACAGTGloB-linker
gloB-gfp-R ACTTCCTGCACTTCCGAACCTATCTTTCTTTG
gapA-gfp-FCACACAGGAAACAGCTATGACTATCAAAGTAGGTATGAPDH-linker
gapA-gfp-R CACTTCCTGCACTTCCTTTGGAGATGTGAGCGAT
(pET)Cpsqr-FTAAGAAGGAGATATACATATGCAACCCCGCGCCCTCpSQR
(pET)Cpsqr-RGTGGTGGTGCTCGAGTCCCTGCAACTCGGGTGT
  • a Underlining indicates sequences overlapping with the linker.