Table 1.

Primer pairs used in PCR to detect phylogenetic groups of native microorganisms and plant material in a N.Mex. sandy loam soil

Organism groupPrimer pair [reference(s)]DNA sequenceProduct size (bp)
BacteriaP3MOD (31,32)ATTAGATACCCTDGTAGTCC723
PC5B TACCTTGTTACGACTT
Bacillusspecies and relativesBacF (30)AGGGTCATTGGAAACTGGG600
BacRCGTGTTGTAGCCCAGGTCATA
High-G+C gram-positive bacteriaActinoF (30)GGCCTTCGGGTTGTAAACC542
ActinoRCTTTGAGTTTTAGCCTTGCGGC
Streptomyces species and related taxaa StreF (21)GAGTTTGATCCTGGCTCAG1,243
StrepRGCCATTGTAGCACGTGTGCA
Fungi, protists, and green algaeNS1 (28)GTAGTCATATGCTTGTCTC555
NS2GGCTGCTGGCACCAGACTTGC
FungiML7 (28)GACCCTATGCAGCTTCTACTG735
ML8TTATCCCTAGCGTAACTTTTATC
PlantsNS3 (5)GCAAGTCTGGTGCCAGCAGCC597
NS4CTTCCGTCAATTCCTTTAAG
  • a Also amplifies members of the firmicutes, Proteobacteria, planctomycetes, chlamydia, and other relatives (21).