Table 1.

Primers used for amplification of DNA from methanotrophic bacteria

Target geneSize of product (bp)PrimerPrimer sequence (5′–3′)aReference
amoA orpmoA 525amo/pmofGGNGACTGGGACTTCTGG 11
amo/pmorGAASGCNGAGAAGAASGC
mmoX 535mmofGGCTCCAAGTTCAAGGTCGAGC 15
mmorTGGCACTCGTAGCGCTCCGGCTCG
16S rDNA1,50716SfAGAGTTTGATCATGGCTCAG 12
16SrTACGGYTACCTTGTTACGACTT
pmoA 330pmof1GGGGGAACTTCTGGGGITGGACThis study
pmorGGGGGRCIACGTCITTACCGAA
pmoA 178pmof2TTCTAYCCDRRCAACTGGCCThis study
pmorGGGGGRCIACGTCITTACCGAA
  • a Y = C or T; D = G, A, or T; R = A or G; S = G or C; N = A, G, C, or T.