Table 1.

Primer sequences and predicted lengths of PCR amplification products

PrimerDirec-tionPrimer sequence (5′-3′)Fragment size (bases)Refer-ence
EHEChly ForwardACGATGTGGTTTATTCTGGA165 12
ReverseCTTCACGTGACCATACATAT
stx1 ForwardACACTGGATGATCTCAGTGG614 13
ReverseCTGAATCCCCCTCCATTATG
stx2 ForwardCCATGACAACGGACAGCAGTT779 13
ReverseCCTGTCAACTGAGCAGCACTTTG
eaeA ForwardGTGGCGAATACTGGCGAGACT890 14
ReverseCCCCATTCTTTTTCACCGTCG