Table 1.

Primer sequences and predicted lengths of PCR amplification products

PrimerDirec-tionPrimer sequence (5′-3′)Fragment size (bases)Refer-ence
EHEChlyForwardACGATGTGGTTTATTCTGGA16512
ReverseCTTCACGTGACCATACATAT
stx1ForwardACACTGGATGATCTCAGTGG61413
ReverseCTGAATCCCCCTCCATTATG
stx2ForwardCCATGACAACGGACAGCAGTT77913
ReverseCCTGTCAACTGAGCAGCACTTTG
eaeAForwardGTGGCGAATACTGGCGAGACT89014
ReverseCCCCATTCTTTTTCACCGTCG