Table 2.

Species-specific primers

Primer pairSpeciesPrimersTargetSequence (5′–3′)PCR annealing temp (°C)MgCl2 concn (mM)
1 L. acidophilus Aci 16SI16S geneAGCTGAACCAACAGATTCAC621.5
16SIIACTACCAGGGTATCTAATCC
2 L. crispatus Cri 16SI16S geneGTAATGACGTTAGGAAAGCG601.5
16SIIACTACCAGGGTATCTAATCC
3 L. gasseri GasI16S-23S spacerGAGTGCGAGAGCACTAAAG552.5
GasIICTATTTCAAGTTGAGTTTCTCT
4 L. johnsonii Joh 16SI16S geneGAGCTTGCCTAGATGATTTTA571.5
16SIIACTACCAGGGTATCTAATCC
5 L. plantarum Lfpr16S-23S spacerGCCGCCTAAGGTGGGACAGAT552.0
PlanIITTACCTAACGGTAAATGCGA
6 L. casei PrI16S-23S spacerCAGACTGAAAGTCTGACGG552.0
CasIIGCGATGCGAATTTCTTTTTC
7 L. zeae ZeaI16S-23S spacerTGTTTAGTTTTGAGGGGACG582.0
ZeaIIATGCGATGCGAATTTCTAAATT
8 L. rhamnosus PrI16S-23S spacerCAGACTGAAAGTCTGACGG582.0
RhaIIGCGATGCGAATTTCTATTATT
9 L. reuteri Lfpr16S-23S spacerGCCGCCTAAGGTGGGACAGAT552.0
ReuAACACTCAAGGATTGTCTGA
10 L. fermentum Lfpr16S-23S spacerGCCGCCTAAGGTGGGACAGAT553.0
FermIICTGATCGTAGATCAGTCAAG
11 L. sharpeae ShaI16S-23S spacerGATAATCATGTAAGAAACCGC581.5
ShaIIATATTGTTGGTCGCGATTCG