Table 1.

Developed and validated 16S rRNA-targeted species-specific oligonucleotide probes for Eubacterium spp. and the corresponding sequence accession numbersa

Probe (accession no.; TD,TH, TE [°C]) and related strainsSequence
S-S-E.bar-1237-a-A-18 (M23927; 51, 51, 53)3′TTACCCAACCCTGTTTCC
5′AAUGGGUUGGGACAAAGG′ (target)
Acidaminococcus fermentans .....UCG.CA.......
Ruminococcus productus C.AU..C...U.......
S-S-E.bif-0462-a-A-18 (M59230; 51, 51, 56)3′CCCTTACTACTCACTCAC
5′GGGAAUGAUGAGUGAGUG′ (target)
Eubacterium cylindroides ATCC 27803 .........CC...G...
Streptococcus pleomorphus ..........UCG.....
Fusobacterium mortiferum ...UG....CU.C..N..
Fusobacterium varium ...UG....CU.C..N..
S-S-E.con-1122-a-A-20 (L34615; 61, 55, 55)3′GGCCTAAACCGCTGGCTACT
5′AGUAGCCAGCGGUUUAGGCC′ (target)
Eubacterium fissicatena ..............G.C.G.
S-St-E.cyl-0461-a-A-18 (L34617; 53, 51, 53)3′TCCCTTACTAGGCACCCA
5′AGGGAAUGAUCCGUGGGU′ (target)
Eubacterium biforme ..........GA...A..
Eubacterium uniforme G.N..G.A.NN.......
Eubacterium cylindroides ATCC 27528 ...A....C.AU......
Fusobacterium varium GA..G...U....A....
S-St-E.cyl-0466-a-A-18 (L34616; 53, 51, 53)3′TACGATACACCCACTGCC
5′AUGCUAUGUGGGUGACGG′ (target)
Clostridium innocuum ........G.A.......
Eubacterium cylindroides ATCC 27803 ..A.CC.........U..
Clostridium spiroforme ..A...CC.A........
Eubacterium biforme ..A..GA...A....U..
S-S-E.dol-0183-a-A-18 (L34682; 55, 51, 53)3′TGTCTCCGAGATGCCTCG
5′CGAGGCAUCUCGGAGACA′ (target)
S-S-E.had-0579-a-A-20 (ARB 671C; 59, 54, 54)3′GACTTGCCATACCACCTACG
5′CGUAGGUGGUAUGGCAAGUC′ (target)
Eubacterium ventriosum ......C..C..........
Eubacterium uniforme ......C.A...........
Bacteroides fragilis .........AC...U.....
S-S-E.len-0194-a-A-18 (AB011817; 55, 51, 53)3′CCTTGCCGTCTGGGCTTT
5′AAAGCCCAGACGGCAAGG′ (target)
Eubacterium ventriosum ......C..C........
Eubacterium uniforme ......C.A.........
Bacteroides fragilis .........AC...U...
S-S-E.lim-1433-a-A-18 (M59120; 55, 51, 59)3′TCGGACACTCTCTTGGCG
5′AGCCUGUGAGAGAACCGC′ (target)
Eubacterium barkeri ....A......C......
Pseudoramibacter alactolyticus ...A......C.......
Eubacterium cylindroides ATCC 27528 ....G...GC.U......
Eubacterium tortuosum ....G...GC.U......
S-S-E.mon-0084-a-A-18 (L34622; 53, 51, 52)3′CCGCTAATCCATTTCCCG
5′CGGGAAAUGGAUUAGCGG′ (target)
S-S-E.ven-0066-a-A-18 (L34421; 51, 55, 50)3′TCTGTCCAAGGTGCTTCG
5′CGAAGCACCUUGGACAGA′ (target)
  • a Alignments of the probe sequences and their 16S rRNA target sites. Also shown are the potential 16S rRNA binding sites of nontarget organisms commonly found in human and animal feces. Accession numbers are from GenBank except for E. hadrum which only has an ARB accession number (46). Probes are named in accordance with the OPD (2). Sequences show the closest nontarget sequences available in the databases. Only nucleotides that differ from the target sequences are shown. N indicates a not yet determined nucleotide. The firstT D refers to the theoretical dissociation temperature based on the contribution of GC and AT pairs to the oligonucleotide duplex stability (45).T H refers to the hybridization temperature used in the study. T E is related to the hybridization temperature as determined by the method by De Los Reyes et al. (11).