TABLE 4

Primers and plasmids for cloning, plasmid construction, and site-directed mutagenesis

PrimerPrimer sequenceaPurpose(s)Yielded plasmid(s)
AAD3_pGS_FGGTACCGACGACGACGACAAGATGATTGGGTCCGCGTCCGScAAD3 cloning to pGS-21apGS-21a-ScAad3
AAD3_pGS_RGCGGCCGCAACATTATTCGTACCATATTT
AAD4_pGS_FGGTACCGACGACGACGACAAGATGGGCTCTATGAATAAGGAACAScAAD4 cloning to pGS-21apGS-21a-ScAad4
AAD4_pGS_RGCGGCCGCATCGAAGGAAATCTGCGCA
AAD14_pGS_FGGTACCGACGACGACGACAAGATGACTGACTTGTTTAAACCTCTScAAD14 cloning to pGS-21apGS-21a-ScAad14
AAD14_pGS_RGCGGCCGCATTGTCAAAAGCTATCCTGGCA
PC_AAD_ORF1_F1_HRGTAATTATCTACTTTTTACAACAAATATAAAACAAGATCTCGACTCTAGAGGATCCATGAACATCTGGGCACCCGSubcloning PcAAD1 from pGS-21a-PcAad1 (Yang et al. [10]), for purpose of overexpression PcAAD1 in yeast BY4747YEplac195PGK/CYC1-JL52-URA3-PcAad1
PC_AAD_ORF1_R1_HRCCAAAGGCCATCTTGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTCTACTTCTGGGGGCGGATAGC
SC_AAD3_F1_HRGTAATTATCTACTTTTTACAACAAATATAAAACAAGATCTCGACTCTAGAGGATCCATGATTGGGTCCGCGTCCGSubcloning ScAAD3 from pGS-21a-ScAad3, for purpose of overexpression ScAAD3 in yeast BY4747YEplac195PGK/CYC1-JL52-URA3-ScAad3
SC_AAD3_R1_HRCCAAAGGCCATCTTGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATGCGGCCGCCTAAACATTATTCGTACCATATTT
SC_AAD4_F1_HRGTAATTATCTACTTTTTACAACAAATATAAAACAAGATCTCGACTCTAGAGGATCCATGGGCTCTATGAATAAGGAACASubcloning ScAAD4 from pGS-21a-ScAad4, for purpose of overexpression ScAAD4 in yeast BY4747YEplac195PGK/CYC1-JL52-URA3-ScAad4
SC_AAD4_R1_HRCCAAAGGCCATCTTGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATGCGGCCGCTTAATCGAAGGAAATCTGCGCA
SC_AAD14_F1_HRGTAATTATCTACTTTTTACAACAAATATAAAACAAGATCTCGACTCTAGAGGATCCATGACTGACTTGTTTAAACCTCTSubcloning ScAAD14 from pGS-21a-ScAad14, for purpose of overexpression ScAAD14 in yeast BY4747YEplac195PGK/CYC1-JL52-URA3-ScAad14
SC_AAD14_R1_HRCCAAAGGCCATCTTGGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATGCGGCCGCCTAATTGTCAAAAGCTATCCTGGCA
PcAad1Tyr76mut2Cys_F1AACTTCATTGATACCGCTAATGTCTGCCAAGACGAGACATCCGAGGAATTTPcAad1p tyrosine73→cysteine73 mutagenesispGS-21a-PcAad1Tyr76Cys
PcAad1Tyr76mut2Cys_R1AAATTCCTCGGATGTCTCGTCTTGGCAGACATTAGCGGTATCAATGAAGTT
ScAad3MutCys2Tyr_BamHI_A1ATCGCGCGGATCCATGATTGGGTCCGCGTCCGACTCATCTAGCScAad3p cysteine73→tyrosine73 mutagenesispGS-21a-ScAad1Cys73 Tyr
ScAad3MutCys2Tyr_B1CCATTCTTCTGATTGCTCGTTTTGGTAGTTGTTTGCGGCATCAATGAAATT
ScAad3MutCys2Tyr_C1AATTTCATTGATGCCGCAAACAACTACCAAAACGAGCAATCAGAAGAATGG
ScAad3MutCys2Tyr_XhoI_D1ATCGCCGCTCGAGAACATTATTCGTACCATATTTTTGAGTCAAGG
ScAad6InserG_F1_AATCGATCGCGCGGATCCATGGCTGATTTATTTGCTCCTGCTCCFusion of ScAAD6-AAD16pGS-21a-ScAad6518G
ScAad6InserG_R1_BAGACACACCCAAATAGAGGACCTTGCCCTGCTGCACTAGAATGTGTAAACT
ScAad6InserG_F2_CAGTTTACACATTCTAGTGCAGCAGGGCAAGGTCCTCTATTTGGGTGTGTCT
ScAad6InserG_R2_DATCGATCGCCGCTCGAGTTAATCGAAGGAAATCTGCGCAGACATTGC
ScAad10Mute_F1_AATCGATCGCGCGGATCCATGTCTGAGGCTTTTGGACCTGCACScAad10-35Cp N truncation repairpGS-21a-ScAad10C-35
ScAad10Mute_R1_BATCCAAGTCTCTGACTGCTCATACTGATAATTATTTGCAGTATCAATGAAATTTCC
ScAad10Mute_F2_CGGAAATTTCATTGATACTGCAAATAATTATCAGTATGAGCAGTCAGAGACTTGGAT
ScAad10Mute_R2_DATCGATCGCCGCTCGAGCTAATCTTCGAAGCTAATCTTGGCA
  • a Italics indicate the enterokinase-coding sequence, boldface indicates start and stop codons, and underlining indicates restriction sites.