Table 1.

Designations and targets of amplification primers and hybridization probes

Primer or probeSequenceaPositionsbTarget
Primers
 27FAGAGTTTGATC(C/A)TGGCTCAG8–27(Eu)bacterial 16S rDNA
 27F(A)AGAGTTTGATC  A TGGCTCAG8–27(Eu)bacterial 16S rDNA containing T at position 19
 27F(C)AGAGTTTGATC  C TGGCTCAG8–27(Eu)bacterial 16S rDNA containing G at position 19
 1492RTACGG(C/T)TACCTTGTTACGACTT1492–1513(Eu)bacterial 16S rDNA
 1492R(T)TACGG  T TACCTTGTTACGACTT1492–1513(Eu)bacterial 16S rDNA containing T at position 1497
 1492R(C)TACGG  C TACCTTGTTACGACTT1492–1513(Eu)bacterial 16S rDNA containing C at position 1497
Probes
 BsuCGCGGGTCCATCTGTAAGTG219–238B. subtilis 16S rDNA
 VanCCTAGGCATATCCTGACGCG219–238V. anguillarum 16S rDNA
 VfiCCTGGGCTAATCTTAGCGCG219–238V. fischeri 16S rDNA
 EcoCTTTACTCCCTTCCTCCCCG443–462E. coli mutagenized 16S rDNA with C [Eco(GC)] or A/T [Eco(AT)] in priming regions
 EcoMCTTTACTGGGAAGCTCCCCG443–462E. coli mutagenized 16S rDNA with A/T in priming region and nucleotides 450 to 455 exchanged [Eco(AT)m]
 EubcGCTGCCTCCCGTAGGAGT338–355(Eu)bacterial 16S rDNA
  • a The nucleotides in boldface type are degenerate nucleotides in amplification primers and their permutations.

  • b E. coli numbering.

  • c Probe Eub is identical to S-D-Bact-0338-a-A-18 (1).