TABLE 2

qPCR primers used to measure gene expression of the listed genesa

PrimerSequenceFinal concn (μM)Annealing temp (°C)Product size (bp)
gyrase-FGGGCGAGGTCATGGGC161134
gyrase-RCGCCGTCTATGGAGCCG0.25
oah2-F3GAGCTCTGGCGGAACTAC0.2556104
oah2-R3AAGGTGCGGACCCTTTC1
merR4-FAGCTTGAGGACATCGCCTGGAT0.561214
merR4-RTCCAAATAGACGCAGCGGTCCC1
merA forGCCTTCAAGATCGTGGTGGACGAAGAG0.562186
merA revCCTGGGCCACGAGCCTTATCC0.25
oah1-F2GGAGCTCGCCTTCATCGTCA159137
oah1-R2TGTTTTCCACGTGACGCTCG0.25
met2-FGAATCGCCATGATGAGCTACC1.255792
met2-RCTGGTAGTCCAGGTAGGTTTCC1.25
oas-FCGCTACCTCAAGGAAAGGATC1.2556145
oas-RGGGAAAGGTCCAGGTTCTCG1.25
metH-FCCTCTTTGACCTCCTTACCTTCC2.55798
metH-RTCTCCCGTAGCTCCTCTATGG2.5
bshA-FCTAGACCTGAGCGCAAGAGG2.558128
bshA-RGAGGCGCTTCCGGATTT2.5
bshB-FCGCCGTTACTTTGGGAACTA2.55876
bshB-RGCACGTAGAGCACGGGAAG2.5
bshC-F2GGAGGCGGAGACGCTTTC1.255581
bshC-R2GGGTCAAAGGGCACAAGC1.25
trxB-FGGTGCGGCTTAAGAACCTAAAG1.2558100
trxB-RCTTGAGGAAAGCGGTGTTGG1.25
trxA1-FGACCAGAACTTTGACGAGACCC1.2560132
trxA1-RAAGCTTCCCCTCGTACTCTTTGG1.25
trxA2-FCCCACCCTGGTCCTCTTCC1.2560105
trxA2-RCCTCCCTTCTAGGTAGGGCCTG1.25
gor-R e coliGCCGTGAATACCGACAATCT0.460130
gor-F e coliCGACGATCAGGTGAAAGTGTAT0.4
trxB-F e coliACAGTCGGGTATTCATGGTAATG0.460110
trxB-R e coliCTGTACCGGCCGAAGTAATG0.4
gshB-F e coliCCCATCGCAAACATCAACATC0.460101
gshB-R e coliAGATCGCCCATCTCCATATAGT0.4
gshA-F e coliCGGATGTGGCCGTTAAGTAT16091
gshA-R e coliTAAAGCGTCCGGTGTTAGAAG1
zntA-FATCAGGTGCAGGTGTTGTT160113
zntA-RTTCATCGCGCAGGGAATAG1
cysM-F ecoliATACGCCTCTGGTGAAGTTG0.56089
cysM-R ecoliCGAACCTGCCGGGTTATT0.5
cysK-F ecoliCGATCTCAAGCTGGTCGATAAA0.460116
cysK-R ecoliCAGCTGCTCCAGAAGAGATAC0.4
MalY-F ecoliGATGAGTTTCTCGCGGCTATT0.56093
MalY-R ecoliGATGACAGAAGGGCCATACAC0.5
ssrA-F EcoliCGCCCGTCACGAATACTTTA0.460110
ssrA-R EcoliACGTAGCTGTCGCTGATATTG0.4
  • a All primers were designed for this study, except for the merA primers, which were from the work of Wang et al. (17).