TABLE 3

Primers and PCR amplification setup for each gene in the present study

LocusPrimer(s)Thermal cycling conditionsReference
BOXA1R5′CTACGGCAAGGCGACGCTGACG3′7 min at 95°C; 34 × 1 min at 94°C, 1 min at 52.8°C, and 8 min at 65°C; 16 min at 65°C26
ITS132F′ (5′CCGGGTTTCCCCATTCGG3′), 1490R′ (5′TGCGGCTGGATCACCTCCTT3′)3 min at 95°C; 34 × 1 min at 94°C, 1 min at 55°C, and 1 min 45 s at 72°C; 3 min at 72°C84
16S rRNAF′ (5′AGAGTTTGATCCTGGCTCAG3′), R′ (5′TACGGTTACCTTGTTACGACTT3′)4 min at 94°C; 35 × 1 min at 94°C, 1 min at 55°C, and 2 min at 72°C; 10 min at 72°C85
gyrB343F′ (5′AGCTTGTCCTTSGTCTGCG3′), 1043R′ (5′TTCGACCAGAAYTCCTAYAAGG3′)2 min at 95°C; 34 × 45 s at 94°C, 30 s at 58°C, and 1 min 30 s at 72°C; 10 min at 72°C86
glnII13F (5′AAGCTCGAGTACATCTGGCTCGACGG3′), 681R (5′SGAGCCGTTCCAGTCGGTGTCG3′)2 min at 95°C; 34 × 45 s at 95°C, 30 s at 65°C, and 1 min 30 s at 72°C; 10 min at 72°C87
rpoB575F (5′ACATCGAGTTCGACGCCAAGG3′), 1054R (5′CATTGACGTGGTCGATGTCG3′)5 min at 95°C; 20 × 45 s at 95°C, 30 s at 60°C (−0.5°C per cycle) and 1 min 30 s at 72°C; 25 × 30 s at 94°C, 30 s at 55°C, 1 min 30 s at 72°C; 10 min at 72°C53
recA8F (5′CAACTGCMYTGCGTATCGTCGAAGG3′), 620R (5′CGGATCTGGTTGATGAAGATCACCATG3′)2 min at 95°C; 34 × 0.4 min at 95°C, 30 s at 67.3°C, and 1 min 30 s at 72°C; 10 min at 72°C87
nifH28F (5′TACGGNAARGGSGGNATCGGCAA3′), 809R (5′AGCATGTCYTCSAGYTCNTCCA3′)5 min at 94°C; 20 × 30 s at 94°C, 30 s at 65°C (−0.5°C per cycle), and 1 min 30 s at 72°C; 24 × 30 s at 94°C, 30 s at 55°C, and 1 min 30 s at 72°C; 10 min at 72°C53